ATG4A (NM_052936) Human Untagged Clone
CAT#: SC313299
ATG4A (untagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1
"NM_052936" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATG4A |
Synonyms | APG4A; AUTL2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_052936, the custom clone sequence may differ by one or more nucleotides
ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAAGAATATCCAG ATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACAGAAAAATCTAAGCTGTTGTC TGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAATTTTCACCAATTGGTGGAACGGGCCCTTCA TCAGATGCTGGTTGGGGATGTATGCTACGCTGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGAC ACTTGGGAAGGGACTGGAGCTGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTG CTTCTTAGATAGAAAAGATTGTTGCTACTCTATCCATCAAATGGCACAAATGGGTGTAGGAGAAGGGAAA TCAATTGGAGAATGGTTTGGACCAAATACAGTTGCACAGGTGTTAAAAAAACTTGCTTTATTTGACGAAT GGAATTCCTTGGCTGTTTATGTTTCAATGGATAACACAGTGGTCATTGAAGATATCAAAAAAATGTGCCG TGTCCTTCCCTTGAGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGT AAGGGCACCTCTGCCTACTGCTCAGCCTGGAAACCCCTGCTGCTCATTGTGCCCCTTCGCCTGGGCATAA ACCAAATCAATCCTGTCTATGTTGATGCATTCAAAGAGTGTTTTAAGATGCCACAGTCTTTAGGGGCATT AGGAGGAAAACCAAATAACGCGTATTATTTCATAGGATTCTTAGGTGACGAGCTCATCTTCTTGGACCCT CATACAACCCAGACCTTTGTTGACACTGAAGAGAATGGAACGGTTAATGACCAGACTTTCCATTGCCTGC AGTCCCCACAGCGAATGAACATCCTAAACCTGGATCCTTCAGTTGCATTGGGATTTTTCTGCAAAGAAGA AAAAGACTTTGATAACTGGTGTAGCCTTGTTCAGAAGGAAATTCTAAAGGAGAATTTAAGGATGTTTGAA TTAGTTCAGAAACATCCATCACACTGGCCTCCCTTTGTACCTCCAGCCAAGCCAGAAGTGACAACCACTG GGGCAGAATTCATTGACTCTACTGAGCAACTGGAGGAGTTTGATCTGGAGGAAGATTTTGAGATTCTGAG TGTGTAG |
Restriction Sites | SgfI-RsrII |
ACCN | NM_052936 |
ORF Size | 1197 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_052936.4, NP_443168.2 |
RefSeq Size | 2328 |
RefSeq ORF | 1197 |
Locus ID | 115201 |
Domains | Peptidase_C54 |
Protein Families | Protease |
Protein Pathways | Regulation of autophagy |
Gene Summary | Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (1) encodes isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218030 | ATG4A (Myc-DDK-tagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1 |
USD 420.00 |
|
RG218030 | ATG4A (GFP-tagged) - Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1 |
USD 460.00 |
|
RC218030L3 | Lenti-ORF clone of ATG4A (Myc-DDK-tagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1 |
USD 620.00 |
|
RC218030L4 | Lenti-ORF clone of ATG4A (mGFP-tagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review