ATG4A (NM_052936) Human Untagged Clone

CAT#: SC313299

ATG4A (untagged)-Human ATG4 autophagy related 4 homolog A (S. cerevisiae) (ATG4A), transcript variant 1


  "NM_052936" in other vectors (4)

Reconstitution Protocol

USD 680.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ATG4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATG4A
Synonyms APG4A; AUTL2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_052936, the custom clone sequence may differ by one or more nucleotides


ATGGAGTCAGTTTTATCCAAGTATGAAGATCAGATTACTATTTTCACTGACTACCTAGAAGAATATCCAG
ATACAGATGAGCTGGTATGGATCTTAGGGAAGCAGCATCTCCTTAAAACAGAAAAATCTAAGCTGTTGTC
TGATATAAGTGCTCGTCTATGGTTTACATACAGAAGGAAATTTTCACCAATTGGTGGAACGGGCCCTTCA
TCAGATGCTGGTTGGGGATGTATGCTACGCTGTGGACAGATGATGCTGGCTCAAGCCCTTATCTGTAGAC
ACTTGGGAAGGGACTGGAGCTGGGAGAAACAAAAAGAACAACCCAAAGAATACCAACGCATCCTACAGTG
CTTCTTAGATAGAAAAGATTGTTGCTACTCTATCCATCAAATGGCACAAATGGGTGTAGGAGAAGGGAAA
TCAATTGGAGAATGGTTTGGACCAAATACAGTTGCACAGGTGTTAAAAAAACTTGCTTTATTTGACGAAT
GGAATTCCTTGGCTGTTTATGTTTCAATGGATAACACAGTGGTCATTGAAGATATCAAAAAAATGTGCCG
TGTCCTTCCCTTGAGTGCTGACACAGCTGGTGACAGGCCTCCCGATTCTTTAACTGCTTCAAACCAGAGT
AAGGGCACCTCTGCCTACTGCTCAGCCTGGAAACCCCTGCTGCTCATTGTGCCCCTTCGCCTGGGCATAA
ACCAAATCAATCCTGTCTATGTTGATGCATTCAAAGAGTGTTTTAAGATGCCACAGTCTTTAGGGGCATT
AGGAGGAAAACCAAATAACGCGTATTATTTCATAGGATTCTTAGGTGACGAGCTCATCTTCTTGGACCCT
CATACAACCCAGACCTTTGTTGACACTGAAGAGAATGGAACGGTTAATGACCAGACTTTCCATTGCCTGC
AGTCCCCACAGCGAATGAACATCCTAAACCTGGATCCTTCAGTTGCATTGGGATTTTTCTGCAAAGAAGA
AAAAGACTTTGATAACTGGTGTAGCCTTGTTCAGAAGGAAATTCTAAAGGAGAATTTAAGGATGTTTGAA
TTAGTTCAGAAACATCCATCACACTGGCCTCCCTTTGTACCTCCAGCCAAGCCAGAAGTGACAACCACTG
GGGCAGAATTCATTGACTCTACTGAGCAACTGGAGGAGTTTGATCTGGAGGAAGATTTTGAGATTCTGAG
TGTGTAG


Restriction Sites SgfI-RsrII     
ACCN NM_052936
ORF Size 1197 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_052936.4, NP_443168.2
RefSeq Size 2328
RefSeq ORF 1197
Locus ID 115201
Domains Peptidase_C54
Protein Families Protease
Protein Pathways Regulation of autophagy
Gene Summary Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1) encodes isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.