FGFR1 Oncogene Partner (FGFR1OP) (NM_007045) Human Untagged Clone

CAT#: SC313303

FGFR1OP (untagged)-Human FGFR1 oncogene partner (FGFR1OP), transcript variant 1


  "NM_007045" in other vectors (4)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FGFR1OP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGFR1OP
Synonyms FOP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_007045, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGACGGCGGCCGCAGTGGTGGCCGAGGAGGACACGGAGCTGCGGGACCTGCTGGTGCAGACGC
TGGAGAACAGCGGGGTCCTGAACCGCATCAAGGCTGAACTCCGAGCAGCTGTGTTTTTAGCACTAGAGGA
GCAAGAAAAAGTAGAGAACAAAACTCCTTTAGTTAATGAGAGCCTGAAAAAGTTTTTAAATACCAAAGAC
GGTCGTTTAGTGGCTAGTCTTGTTGCAGAATTTCTTCAGTTTTTTAACCTTGACTTTACTTTGGCTGTTT
TTCAACCTGAAACTAGCACACTGCAAGGTCTCGAAGGTCGAGAGAATTTAGCCCGAGATTTAGGTATAAT
TGAAGCAGAAGGTACTGTGGGTGGACCCTTATTATTAGAAGTGATCAGGCGCTGTCAACAGAAAGAAAAA
GGGCCAACCACTGGGGAAGGTGCACTTGATCTATCTGATGTACATTCTCCACCAAAGTCACCAGAGGGAA
AAACAAGTGCACAGACAACACCAAGTAAGATACCAAGGTATAAAGGACAAGGTAAGAAGAAGACAAGCGG
GCAGAAGGCTGGTGACAAGAAGGCCAATGATGAGGCCAATCAGAGTGATACAAGTGTCTCCTTGTCAGAA
CCCAAGAGCAAAAGCAGCCTTCACTTACTGTCCCATGAAACAAAAATTGGATCTTTTCTAAGCAACAGAA
CTTTAGATGGCAAAGACAAAGCTGGCCTTTGTCCAGATGAAGATGATATGGAAGGAGATTCTTTCTTTGA
TGATCCCATTCCTAAGCCAGAGAAAACTTACGGTTTGAGGAAGGAACCTAGGAAGCAAGCAGGAAGTCTG
GCCTCGCTCTCGGATGCACCCCCCTTAAAAAGTGGACTCAGCTCCCTGGCGGGAGCCCCTTCTTTAAAAG
ACTCTGAGAGTAAAAGGGGAAATACAGTTTTGAAAGATCTGAAATTGATCAGTGATAAAATTGGATCACT
TGGATTAGGAACTGGAGAAGATGATGACTATGTTGATGATTTTAATAGTACCAGCCATCGCTCAGAGAAA
AGTGAGATAAGTATTGGTGAAGAGATAGAAGAAGACCTTTCTGTGGAAATAGATGACATCAATACCAGTG
ATAAGCTTGATGACCTCACACAAGATCTGACTGTATCCCAGCTCAGTGATGTTGCGGATTATCTGGAAGA
TGTTGCATAG


Restriction Sites SgfI-MluI     
ACCN NM_007045
ORF Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_007045.3, NP_008976.1
RefSeq Size 3736
RefSeq ORF 1200
Locus ID 11116
Protein Families Druggable Genome
Gene Summary This gene encodes a largely hydrophilic centrosomal protein that is required for anchoring microtubules to subcellular structures. A t(6;8)(q27;p11) chromosomal translocation, fusing this gene and the fibroblast growth factor receptor 1 (FGFR1) gene, has been found in cases of myeloproliferative disorder. The resulting chimeric protein contains the N-terminal leucine-rich region of this encoded protein fused to the catalytic domain of FGFR1. Alterations in this gene may also be associated with Crohn's disease, Graves' disease, and vitiligo. Alternatively spliced transcript variants that encode different proteins have been identified. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.