OAS1 (NM_016816) Human Untagged Clone

CAT#: SC313306

OAS1 (untagged)-Human 2',5'-oligoadenylate synthetase 1, 40/46kDa (OAS1), transcript variant 1


  "NM_016816" in other vectors (6)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "OAS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OAS1
Synonyms E18/E16; IFI-4; OIAS; OIASI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016816, the custom clone sequence may differ by one or more nucleotides


ATGATGGATCTCAGAAATACCCCAGCCAAATCTCTGGACAAGTTCATTGAAGACTATCTCTTGCCAGACA
CGTGTTTCCGCATGCAAATCAACCATGCCATTGACATCATCTGTGGGTTCCTGAAGGAAAGGTGCTTCCG
AGGTAGCTCCTACCCTGTGTGTGTGTCCAAGGTGGTAAAGGGTGGCTCCTCAGGCAAGGGCACCACCCTC
AGAGGCCGATCTGACGCTGACCTGGTTGTCTTCCTCAGTCCTCTCACCACTTTTCAGGATCAGTTAAATC
GCCGGGGAGAGTTCATCCAGGAAATTAGGAGACAGCTGGAAGCCTGTCAAAGAGAGAGAGCATTTTCCGT
GAAGTTTGAGGTCCAGGCTCCACGCTGGGGCAACCCCCGTGCGCTCAGCTTCGTACTGAGTTCGCTCCAG
CTCGGGGAGGGGGTGGAGTTCGATGTGCTGCCTGCCTTTGATGCCCTGGGTCAGTTGACTGGCGGCTATA
AACCTAACCCCCAAATCTATGTCAAGCTCATCGAGGAGTGCACCGACCTGCAGAAAGAGGGCGAGTTCTC
CACCTGCTTCACAGAACTACAGAGAGACTTCCTGAAGCAGCGCCCCACCAAGCTCAAGAGCCTCATCCGC
CTAGTCAAGCACTGGTACCAAAATTGTAAGAAGAAGCTTGGGAAGCTGCCACCTCAGTATGCCCTGGAGC
TCCTGACGGTCTATGCTTGGGAGCGAGGGAGCATGAAAACACATTTCAACACAGCCCAGGGATTTCGGAC
GGTCTTGGAATTAGTCATAAACTACCAGCAACTCTGCATCTACTGGACAAAGTATTATGACTTTAAAAAC
CCCATTATTGAAAAGTACCTGAGAAGGCAGCTCACGAAACCCAGGCCTGTGATCCTGGACCCGGCGGACC
CTACAGGAAACTTGGGTGGTGGAGACCCAAAGGGTTGGAGGCAGCTGGCACAAGAGGCTGAGGCCTGGCT
GAATTACCCATGCTTTAAGAATTGGGATGGGTCCCCAGTGAGCTCCTGGATTCTGCTGGCTGAAAGCAAC
AGTGCAGACGATGAGACCGACGATCCCAGGAGGTATCAGAAATATGGTTACATTGGAACACATGAGTACC
CTCATTTCTCTCATAGACCCAGCACACTCCAGGCAGCATCCACCCCACAGGCAGAAGAGGACTGGACCTG
CACCATCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_016816
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016816.3, NP_058132.2
RefSeq Size 1830 bp
RefSeq ORF 1203 bp
Locus ID 4938
Cytogenetics 12q24.13
Protein Families Druggable Genome
Gene Summary 'This gene is induced by interferons and encodes a protein that synthesizes 2',5'-oligoadenylates (2-5As). This protein activates latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. Alternative splicing results in multiple transcript variants with different enzymatic activities. Polymorphisms in this gene have been associated with susceptibility to viral infection and diabetes mellitus, type 1. A disease-associated allele in a splice acceptor site influences the production of the p46 splice isoform. This gene is located in a cluster of related genes on chromosome 12. [provided by RefSeq, Feb 2016]'
Transcript Variant: This variant (1) represents the longest transcript. It encodes isoform 1 (also known as E18 and p46). This variant is produced in individuals with a G allele at a polymorphic splice acceptor site in the 3' most intron(PMID:15732009).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.