KRT13 (NM_002274) Human Untagged Clone

CAT#: SC313385

KRT13 (untagged)-Human keratin 13 (KRT13), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KRT13
• Synonyms: CK13; K13; WSN2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002274, the custom clone sequence may differ by one or more nucleotides
  ATGAGCCTCCGCCTGCAGAGCTCCTCTGCCAGCTATGGAGGTGGTTTCGGGGGTGGCTCT
  TGCCAGCTGGGAGGAGGCCGTGGTGTCTCTACCTGTTCAACTCGGTTTGTGTCTGGGGGA
  TCAGCTGGGGGCTATGGAGGCGGCGTGAGCTGTGGTTTTGGTGGAGGGGCTGGTAGTGGC
  TTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGC
  TTTGGTGGGGGTTTTGCTGGTGGCTTTGTTGACTTTGGTGCTTGTGATGGCGGCCTCCTC
  ACTGGCAATGAGAAGATCACCATGCAGAACCTCAACGACCGCCTGGCTTCCTACCTGGAG
  AAGGTGCGCGCCCTGGAGGAGGCCAACGCTGACCTGGAGGTGAAGATCCGTGACTGGCAC
  CTGAAGCAGAGCCCAGCTAGCCCTGAGCGGGACTACAGCCCCTACTACAAGACCATTGAA
  GAGCTCCGGGACAAGATCCTGACCGCCACCATTGAAAACAACCGGGTCATCCTGGAGATT
  GACAATGCCAGGCTGGCTGTGGACGACTTCAGGCTCAAGTATGAGAATGAGCTGGCCCTG
  CGCCAGAGCGTGGAGGCCGACATCAACGGCCTGCGCCGGGTGCTGGATGAGCTCACTCTG
  TCTAAGACTGACCTGGAGATGCAGATCGAGAGCCTGAATGAAGAGCTAGCCTACATGAAG
  AAGAACCATGAAGAGGAGATGAAGGAATTTAGCAACCAGGTGGTCGGCCAGGTCAACGTG
  GAGATGGATGCCACCCCAGGCATTGACCTGACCCGCGTGCTGGCAGAGATGAGGGAGCAG
  TACGAGGCCATGGCAGAGAGGAACCGCCGGGATGCTGAGGAATGGTTCCACGCCAAGAGT
  GCAGAGCTGAACAAGGAGGTGTCTACCAACACTGCCATGATTCAGACCAGCAAGACAGAG
  ATCACGGAGCTCAGGCGCACGCTCCAAGGCCTGGAGATTGAGCTGCAGTCCCAGCTGAGC
  ATGAAAGCGGGGCTGGAGAACACGGTGGCAGAGACGGAGTGCCGCTATGCCCTGCAGCTG
  CAGCAGATCCAGGGACTCATCAGCAGCATCGAGGCCCAGCTGAGCGAGCTCCGCAGTGAG
  ATGGAGTGCCAGAACCAAGAGTACAAGATGCTGCTGGACATCAAGACACGTCTGGAGCAG
  GAGATCGCCACCTACCGCAGCCTGCTCGAGGGCCAGGACGCCAAGAAGCGTCAGCCCCCG
  
• Restriction Sites: Please inquire
• ACCN: NM_002274
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002274.2, NP_002265.1
• RefSeq Size: 1693 bp
• RefSeq ORF: 1263 bp
• Locus ID: 3860
• Cytogenetics: 17q21.2
• Domains: filament
• Gene Summary: 'The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon, compared to transcript variant 1. The encoded isoform (b) is shorter, compared to isoform a.