NRXN3 (NM_138970) Human Untagged Clone

CAT#: SC313436

NRXN3 (untagged)-Human neurexin 3 (NRXN3), transcript variant 2


  "NM_138970" in other vectors (6)

Reconstitution Protocol

USD 730.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NRXN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRXN3
Synonyms C14orf60
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138970, the custom clone sequence may differ by one or more nucleotides


ATGCACCTGAGAATCCACGCGAGACGGAGCCCTCCTCGCCGGCCGGCCTGGACGCTTGGGATCTGGTTCC
TGTTCTGGGGATGTATCGTCAGCTCTGTATGGAGTTCTTCTAATGTAGCTTCCTCCTCCTCCACCTCTTC
CTCGCCGGGGTCTCACTCTCAGCACGAGCACCATTTCCATGGCAGCAAGCATCACTCAGTGCCTATTTCT
ATCTATCGTTCCCCTGTTTCCCTTCGAGGAGGACACGCTGGCGCTACGTACATCTTTGGGAAAAGTGGTG
GGCTTATCCTCTACACCTGGCCAGCCAATGACAGGCCCAGCACGCGGTCTGACCGCCTTGCCGTGGGCTT
CAGCACCACTGTGAAGGATGGCATCTTGGTCCGCATCGACAGTGCTCCAGGACTTGGTGACTTCCTCCAG
CTTCACATAGAACAGGGGAAAATTGGAGTTGTCTTCAACATTGGCACAGTTGACATCTCCATCAAAGAGG
AGAGAACCCCTGTAAATGACGGCAAATACCATGTGGTACGCTTCACCAGGAACGGCGGCAACGCCACCCT
GCAGGTGGACAACTGGCCAGTGAATGAACATTATCCTACAGGCCGGCAGTTAACCATCTTCAACACTCAG
GCGCAAATAGCCATTGGTGGAAAGGACAAAGGACGCCTCTTCCAAGGCCAACTCTCTGGGCTCTATTATG
ATGGTTTGAAAGTACTGAACATGGCGGCTGAGAACAACCCCAATATTAAAATCAATGGAAGTGTTCGGCT
GGTTGGAGAAGTCCCATCAATTTTGGGAACAACACAGACGACCTCCATGCCACCAGAAATGTCTACTACT
GTCATGGAAACCACTACTACAATGGCGACTACCACAACCCGTAAGAATCGCTCTACAGCCAGCATTCAGC
CAACATCAGATGATCTTGTTTCATCTGCTGAATGTTCAAGTGATGATGAAGACTTTGTTGAATGTGAGCC
GAGTACAGGTAGGTCAGCAAACCCCACGGAGCCGGGAATCAGACGGGTTCCGGGGGCCTCAGAGGTGATC
CGGGAGTCGAGCAGCACAACAGGGATGGTCGTCGGCATTGTGGCTGCTGCCGCCCTCTGCATCTTGATCC
TCCTGTACGCCATGTACAAGTACAGGAACAGGGACGAGGGGTCCTATCAAGTGGACGAGACGCGGAACTA
CATCAGCAACTCCGCCCAGAGCAACGGCACGCTCATGAAGGAGAAGCAGCAGAGCTCGAAGAGCGGCCAC
AAGAAACAGAAAAACAAGGACAGGGAGTATTACGTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_138970
ORF Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138970.4, NP_620426.2
RefSeq Size 8578
RefSeq ORF 1299
Locus ID 9369
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
Gene Summary This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and contains multiple differences in the coding region, including the lack of multiple 5' exons, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. This variant encodes a beta isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.