TGF beta 2 (TGFB2) (M19154) Human Untagged Clone
CAT#: SC313495
(untagged)-Human transforming growth factor-beta-2 mRNA, complete cds
Product Images
Other products for "TGFB2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TGFB2 |
Synonyms | LDS4|TGF-beta2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for M19154, the custom clone sequence may differ by one or more nucleotides
ATGCACTACTGTGTGCTGAGCGCTTTTCTGATCCTGCATCTGGTCACGGTCGCGCTCAGC CTGTCTACCTGCAGCACACTCGATATGGACCAGTTCATGCGCAAGAGGATCGAGGCGATC CGCGGGCAGATCCTGAGCAAGCTGAAGCTCACCAGTCCCCCAGAAGACTATCCTGAGCCC GAGGAAGTCCCCCCGGAGGTGATTTCCATCTACAACAGCACCAGGGACTTGCTCCAGGAG AAGGCGAGCCGGAGGGCGGCCGCCTGCGAGCGCGAGAGGAGCGACGAAGAGTACTACGCC AAGGAGGTTTACAAAATAGACATGCCGCCCTTCTTCCCCTCCGAAACTGTCTGCCCAGTT GTTACAACACCCTCTGGCTCAGTGGGCAGCTTGTGCTCCAGACAGTCCCAGGTGCTCTGT GGGTACCTTGATGCCATCCCGCCCACTTTCTACAGACCCTACTTCAGAATTGTTCGATTT GACGTCTCAGCAATGGAGAAGAATGCTTCCAATTTGGTGAAAGCAGAGTTCAGAGTCTTT CGTTTGCAGAACCCAAAAGCCAGAGTGCCTGAACAACGGATTGAGCTATATCAGATTCTC AAGTCCAAAGATTTAACATCTCCAACCCAGCGCTACATCGACAGCAAAGTTGTGAAAACA AGAGCAGAAGGCGAATGGCTCTCCTTCGATGTAACTGATGCTGTTCATGAATGGCTTCAC CATAAAGACAGGAACCTGGGATTTAAAATAAGCTTACACTGTCCCTGCTGCACTTTTGTA CCATCTAATAATTACATCATCCCAAATAAAAGTGAAGAACTAGAAGCAAGATTTGCAGGT ATTGATGGCACCTCCACATATACCAGTGGTGATCAGAAAACTATAAAGTCCACTAGGAAA AAAAACAGTGGGAAGACCCCACATCTCCTGCTAATGTTATTGCCCTCCTACAGACTTGAG TCACAACAGACCAACCGGCGGAAGAAGCGTGCTTTGGATGCGGCCTATTGCTTTAGAAAT GTGCAGGATAATTGCTGCCTACGTCCACTTTACATTGATTTCAAGAGGGATCTAGGGTGG AAATGGATACACGAACCCAAAGGGTACAATGCCAACTTCTGTGCTGGAGCATGCCCGTAT TTATGGAGTTCAGACACTCAGCACAGCAGGGTCCTGAGCTTATATAATACCATAAATCCA GAAGCATCTGCTTCTCCTTGCTGCGTGTCCCAAGATTTAGAACCTCTAACCATTCTCTAC TACATTGGCAAAACACCCAAGATTGAACAGCTTTCTAATATGATTGTAAAGTCTTGCAAA TGCAGC |
Restriction Sites | Please inquire |
ACCN | M19154 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | M19154.1, AAA50404.1 |
RefSeq Size | 2570 bp |
RefSeq ORF | 690 bp |
Locus ID | 7042 |
Cytogenetics | 1q41 |
Domains | TGFb_propeptide, TGF-beta |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Cytokine-cytokine receptor interaction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma, TGF-beta signaling pathway |
Gene Summary | 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Disruption of the TGF-beta/SMAD pathway has been implicated in a variety of human cancers. A chromosomal translocation that includes this gene is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. Mutations in this gene may be associated with Loeys-Dietz syndrome. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]' |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.