MAP2 (NM_031847) Human Untagged Clone

CAT#: SC313753

MAP2 (untagged)-Human microtubule-associated protein 2 (MAP2), transcript variant 4


  "NM_031847" in other vectors (4)

Reconstitution Protocol

USD 840.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP2
Synonyms MAP-2; MAP2A; MAP2B; MAP2C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_031847, the custom clone sequence may differ by one or more nucleotides


ATGGCAGATGAACGGAAAGATGAAGCAAAGGCACCTCACTGGACCTCAGCACCGCTAACAGAGGCATCTG
CACACTCACATCCACCTGAGATTAAGGATCAAGGCGGAGCAGGGGAAGGACTTGTCCGAAGCGCCAATGG
ATTCCCATACAGGGAGGATGAAGAGGGTGCCTTTGGAGAGCATGGGTCACAGGGCACCTATTCAAATACC
AAAGAGAATGGGATCAACGGAGAGCTGACCTCAGCTGACAGAGAAACAGCAGAGGAGGTGTCTGCAAGGA
TAGTTCAAGTAGTCACTGCTGAGGCTGTAGCAGTCCTGAAAGGTGAACAAGAGAAAGAAGCTCAACATAA
AGACCAGACTGCAGCTCTGCCTTTAGCAGCTGAAGAAACAGCTAATCTGCCTCCTTCTCCACCCCCATCA
CCTGCCTCAGAACAGACTGTCACAGTGGAGGAAGCAGCAGGTGGGGAATCAGCTCTGGCTCCCAGTGTAT
TTAAACAGGCAAAGGACAAAGTCTCTGACGGAGTAACCAAGAGCCCAGAAAAGCGCTCTTCTCTCCCAAG
ACCTTCCTCCATTCTCCCTCCTCGGCGAGGTGTGTCAGGAGACAGAGATGAGAATTCCTTCTCTCTCAAC
AGTTCTATCTCTTCTTCAGCACGGCGGACCACCAGGTCAGAGCCAATTCGCAGAGCAGGGAAGAGTGGTA
CCTCAACACCCACTACCCCTGGGTCTACTGCCATCACTCCTGGCACCCCACCAAGTTATTCTTCACGCAC
ACCAGGCACTCCTGGAACCCCTAGCTATCCCAGGACCCCTCACACACCAGGAACCCCCAAGTCTGCCATC
TTGGTGCCGAGTGAGAAGAAGGTCGCCATCATACGTACTCCTCCAAAATCTCCTGCGACTCCCAAGCAGC
TTCGGCTTATTAACCAACCACTGCCAGACCTGAAGAATGTCAAATCCAAAATCGGATCAACAGACAACAT
CAAATACCAGCCTAAAGGGGGGCAGGTTAGGATTTTAAACAAGAAGATCGATTTTAGCAAAGTTCAGTCC
AGATGTGGTTCCAAGGATAACATCAAACATTCGGCTGGGGGCGGAAATGTACAAATTGTTACCAAGAAAA
TAGACCTAAGCCATGTGACATCCAAATGTGGCTCTCTGAAGAACATCCGCCACAGGCCAGGTGGCGGACG
TGTGAAAATTGAGAGTGTAAAACTAGATTTCAAAGAAAAGGCCCAAGCTAAAGTTGGTTCTCTTGATAAT
GCTCATCATGTACCTGGAGGTGGTAATGTCAAGATTGACAGCCAAAAGTTGAACTTCAGAGAGCATGCTA
AAGCCCGTGTGGACCATGGGGCTGAGATCATTACACAGTCCCCAGGCAGATCCAGCGTGGCATCACCCCG
ACGACTCAGCAATGTCTCCTCGTCTGGAAGCATCAACCTGCTCGAATCTCCTCAGCTTGCCACTTTGGCT
GAGGATGTCACTGCTGCACTCGCTAAGCAGGGCTTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_031847
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_031847.2, NP_114035.2
RefSeq Size 5470 bp
RefSeq ORF 1509 bp
Locus ID 4133
Cytogenetics 2q34
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS
Gene Summary 'This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (4) includes an alternate in-frame exon, compared to variant 2, resulting in a longer protein (isoform 4), compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.