TAK1 (MAP3K7) (NM_145332) Human Untagged Clone

CAT#: SC313824

MAP3K7 (untagged)-Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C


  "NM_145332" in other vectors (4)

Reconstitution Protocol

USD 880.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP3K7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP3K7
Synonyms CSCF; FMD2; MEKK7; TAK1; TGF1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_145332, the custom clone sequence may differ by one or more nucleotides


ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCGAAGCCCCTTCCC
AGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGCCTT
TGGAGTTGTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAGAAAGTGAATCTGAG
AGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATCCCGTGTGAACCATCCTAATATTGTAAAGCTTTATG
GAGCCTGCTTGAATCCAGTGTGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATGTGCTGCA
TGGTGCTGAACCATTGCCATATTATACTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGA
GTGGCTTATCTTCACAGCATGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGC
TGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATTCAGACACACATGAC
CAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTTTTTGAAGGTAGTAATTACAGTGAAAAATGT
GACGTCTTCAGCTGGGGTATTATTCTTTGGGAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTG
GCCCAGCTTTCCGAATCATGTGGGCTGTTCATAATGGTACTCGACCACCACTGATAAAAAATTTACCTAA
GCCCATTGAGAGCCTGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATT
GTGAAAATAATGACTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTATCCTTGTCAGT
ATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGGCTCATTCATGGACATTGCTTCTACAAATAC
GAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCCACAAATGATACTATTAAGCGCTTAGAATCA
AAATTGTTGAAAAATCAGGCAAAGCAACAGAGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGA
GCAGTGTGGAGAGCTTGCCCCCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGC
TAGGATCGCCGCAACCACAGCCTATTCCAAGCCTAAACGGGGCCACCGTAAAACTGCTTCATTTGGCAAC
ATTCTGGATGTCCCTGAGATCGTCATATCAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACTTGA
CTGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCAGTGTCAGAATGATTACTAC
CTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCATGGACCCCTGATGATTCCACAGATACCAAT
GGATCAGATAACTCCATCCCAATGGCTTATCTTACACTGGATCACCAACTACAGGCAAGAACTAGTTGCA
GAACTGGACCAGGATGA


Restriction Sites SgfI-RsrII     
ACCN NM_145332
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145332.2, NP_663305.1
RefSeq Size 5056 bp
RefSeq ORF 1557 bp
Locus ID 6885
Cytogenetics 6q15
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Adherens junction, MAPK signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Wnt signaling pathway
Gene Summary 'The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (C) lacks a segment, which leads to a frameshift, compared to variant B. The resulting isoform (C) contains a distinct and shorter C-terminus, as compared to isoform B. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.