TAK1 (MAP3K7) (NM_145332) Human Untagged Clone
CAT#: SC313824
MAP3K7 (untagged)-Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C
"NM_145332" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAP3K7 |
Synonyms | CSCF; FMD2; MEKK7; TAK1; TGF1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_145332, the custom clone sequence may differ by one or more nucleotides
ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCGAAGCCCCTTCCC AGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGCCTT TGGAGTTGTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAGAAAGTGAATCTGAG AGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATCCCGTGTGAACCATCCTAATATTGTAAAGCTTTATG GAGCCTGCTTGAATCCAGTGTGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATGTGCTGCA TGGTGCTGAACCATTGCCATATTATACTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGA GTGGCTTATCTTCACAGCATGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGC TGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATTCAGACACACATGAC CAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTTTTTGAAGGTAGTAATTACAGTGAAAAATGT GACGTCTTCAGCTGGGGTATTATTCTTTGGGAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTG GCCCAGCTTTCCGAATCATGTGGGCTGTTCATAATGGTACTCGACCACCACTGATAAAAAATTTACCTAA GCCCATTGAGAGCCTGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATT GTGAAAATAATGACTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTATCCTTGTCAGT ATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGGCTCATTCATGGACATTGCTTCTACAAATAC GAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCCACAAATGATACTATTAAGCGCTTAGAATCA AAATTGTTGAAAAATCAGGCAAAGCAACAGAGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGA GCAGTGTGGAGAGCTTGCCCCCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGC TAGGATCGCCGCAACCACAGCCTATTCCAAGCCTAAACGGGGCCACCGTAAAACTGCTTCATTTGGCAAC ATTCTGGATGTCCCTGAGATCGTCATATCAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACTTGA CTGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCAGTGTCAGAATGATTACTAC CTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCATGGACCCCTGATGATTCCACAGATACCAAT GGATCAGATAACTCCATCCCAATGGCTTATCTTACACTGGATCACCAACTACAGGCAAGAACTAGTTGCA GAACTGGACCAGGATGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_145332 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145332.2, NP_663305.1 |
RefSeq Size | 5056 bp |
RefSeq ORF | 1557 bp |
Locus ID | 6885 |
Cytogenetics | 6q15 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Adherens junction, MAPK signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Wnt signaling pathway |
Gene Summary | 'The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (C) lacks a segment, which leads to a frameshift, compared to variant B. The resulting isoform (C) contains a distinct and shorter C-terminus, as compared to isoform B. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213823 | MAP3K7 (Myc-DDK-tagged)-Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C |
USD 470.00 |
|
RG213823 | MAP3K7 (GFP-tagged) - Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C |
USD 520.00 |
|
RC213823L3 | Lenti ORF clone of Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C, Myc-DDK-tagged |
USD 670.00 |
|
RC213823L4 | Lenti ORF clone of Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant C, mGFP tagged |
USD 670.00 |
{0} Product Review(s)
Be the first one to submit a review