CDC2L1 (CDK11B) (NM_033487) Human Untagged Clone

CAT#: SC313865

CDK11B (untagged)-Human cyclin-dependent kinase 11B (CDK11B), transcript variant 3


  "NM_033487" in other vectors (4)

Reconstitution Protocol

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDK11B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK11B
Synonyms CDC2L1; CDK11; CDK11-p46; CDK11-p58; CDK11-p110; CLK-1; p58; p58CDC2L1; p58CLK-1; PITSLREA; PK58
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_033487, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAAAGGGACCTGCTGTCCGACTTACAGGACATCAGCGACAGCGAGAGGAAGACC
AGCTCGGCCGAGTCCTCGTCAGCAGAATCAGGCTCAGGTTCTGAGGAAGAAGAGGAGGAG
GAGGAAGAGGAGGAGGAGGAAGGGAGCACCAGTGAAGAATCAGAGGAGGAGGAGGAGGAA
GAGGAAGAGGAGGAGGAGGAGACCGGCAGCAACTCTGAGGAGGCATCAGAGCAGTCTGCC
GAAGAAGTAAGTGAGGAAGAAATGAGTGAAGATGAAGAACGAGAAAATGAAAACCACCTC
TTGGTTGTTCCAGAGTCACGGTTCGACCGAGATTCCGGGGAGAGTGAAGAAGCAGAGGAA
GAAGTGGGTGAGGGAACGCCGCAGAGCAGCGCCCTGACAGAGGGCGACTATGTGCCCGAC
TCCCCTGCCCTGTCGCCCATCGAGCTCAAGCAGGAGCTGCCCAAGTACCTGCCGGCCCTG
CAGGGCTGCCGGAGCGTCGAGGAGTTCCAGTGCCTGAACAGGATCGAGGAGGGCACCTAT
GGAGTGGTCTACAGAGCAAAAGACAAGAAAACAGATGAAATTGTGGCTCTAAAGCGGCTG
AAGATGGAGAAGGAGAAGGAGGGCTTCCCGATCACGTCGCTGAGGGAGATCAACACCATC
CTCAAGGCCCAGCATCCCAACATCGTCACCGTTAGAGAGATTGTGGTGGGCAGCAACATG
GACAAGATCTACATCGTGATGAACTATGTGGAGCACGACCTCAAGAGCCTGATGGAGACC
ATGAAACAGCCCTTCCTGCCAGGGGAGGTGAAGACCCTGATGATCCAGCTGCTGCGTGGG
GTGAAACACCTGCACGACAACTGGATCCTGCACCGTGACCTCAAGACGTCCAACCTGCTG
CTGAGCCACGCCGGCATCCTCAAGGTGGGTGACTTCGGGCTGGCGCGGGAGTACGGATCC
CCTCTGAAGGCCTACACCCCGGTCGTGGTGACCCTGTGGTACCGCGCCCCAGAGCTGCTG
CTTGGTGCCAAGGAATACTCCACGGCCGTGGACATGTGGTCAGTGGGTTGCATCTTCGGG
GAGCTGCTGACTCAGAAGCCTCTGTTCCCCGGGAAGTCAGAAATCGATCAGATCAACAAG
GTGTTCAAGGATCTGGGGACCCCTAGTGAGAAAATCTGGCCCGGCTACAGCGAGCTCCCA
GCAGTCAAGAAGATGACCTTCAGCGAGCACCCCTACAACAACCTCCGCAAGCGCTTCGGG
GCTCTGCTCTCAGACCAGGGCTTCGACCTCATGAACAAGTTCCTGACCTACTTCCCCGGG
AGGAGGATCAGCGCTGAGGACGGCCTCAAGCATGAGTATTTCCGCGAGACCCCCCTCCCC
ATCGACCCCTCCATGTTCCCCACGTGGCCCGCCAAGAGCGAGCAGCAGCGTGTGAAGCGG
GGCACCAGCCCGAGGCCCCCTGAGGGAGGCCTGGGCTACAGCCAGCTGGGTGACGACGAC
CTGAAGGAGACGGGCTTCCACCTTACCACCACGAACCAGGGGGCCTCTGCCGCGGGCCCC
GGCTTCAGCCTCAAGTTC
Restriction Sites Please inquire     
ACCN NM_033487
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033487.1, NP_277022.1
RefSeq Size 2226 bp
RefSeq ORF 1581 bp
Locus ID 984
Cytogenetics 1p36.33
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.