COCH (NM_004086) Human Untagged Clone

CAT#: SC313960

COCH (untagged)-Human coagulation factor C homolog, cochlin (Limulus polyphemus) (COCH), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: COCH
• Synonyms: COCH-5B2; COCH5B2; DFNA9; DFNB110
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001135058 edited
  ATGTCCGCAGCCTGGATCCCGGCTCTCGGCCTCGGTGTGTGTCTGCTGCTGCTGCCGGGG
  CCCGCGGGCAGCGAGGGAGCCGCTCCCATTGCTATCACATGTTTTACCAGAGGCTTGGAC
  ATCAGGAAAGAGAAAGCAGATGTCCTCTGCCCAGGGGGCTGCCCTCTTGAGGAATTCTCT
  GTGTATGGGAACATAGTATATGCTTCTGTATCGAGCATATGTGGGGCTGCTGTCCACAGG
  GGAGTAATCAGCAACTCAGGGGGACCTGTACGAGTCTATAGCCTACCTGGTCGAGAAAAC
  TATTCCTCAGTAGATGCCAATGGCATCCAGTCTCAAATGCTTTCTAGATGGTCTGCTTCT
  TTCACAGTAACTAAAGGCAAAAGTAGTACACAGGAGGCCACAGGACAAGCAGTGTCCACA
  GCACATCCACCAACAGGTAAACGACTAAAGAAAACACCCGAGAAGAAAACTGGCAATAAA
  GATTGTAAAGCAGACATTGCATTTCTGATTGATGGAAGCTTTAATATTGGGCAGCGCCGA
  TTTAATTTACAGAAGAATTTTGTTGGAAAAGTGGCTCTAATGTTGGGAATTGGAACAGAA
  GGACCACATGTGGGCCTTGTTCAAGCCAGTGAACATCCCAAAATAGAATTTTACTTGAAA
  AACTTTACATCAGCCAAAGATGTTTTGTTTGCCATAAAGGAAGTAGGTTTCAGAGGGGGT
  AATTCCAATACAGGAAAAGCCTTGAAGCATACTGCTCAGAAATTCTTCACGGTAGATGCT
  GGAGTAAGAAAAGGGATCCCCAAAGTGGTGGTGGTATTTATTGATGGTTGGCCTTCTGAT
  GACATCGAGGAAGCAGGCATTGTGGCCAGAGAGTTTGGTGTCAATGTATTTATAGTTTCT
  GTGGCCAAGCCTATCCCTGAAGAACTGGGGATGGTTCAGGATGTCACATTTGTTGACAAG
  GCTGTCTGTCGGAATAATGGCTTCTTCTCTTACCACATGCCCAACTGGTTTGGCACCACA
  AAATACGTAAAGCCTCTGGTACAGAAGCTGTGCACTCATGAACAAATGATGTGCAGCAAG
  ACCTGTTATAACTCAGTGAACATTGCCTTTCTAATTGATGGCTCCAGCAGTGTTGGAGAT
  AGCAATTTCCGCCTCATGCTTGAATTTGTTTCCAACATAGCCAAGACTTTTGAAATCTCG
  GACATTGGTGCCAAGATAGCTGCTGTACAGTTTACTTATGATCAGCGCACGGAGTTCAGT
  TTCACTGACTATAGCACCAAAGAGAATGTCCTAGCTGTCATCAGAAACATCCGCTATATG
  AGTGGTGGAACAGCTACTGGTGATGCCATTTCCTTCACTGTTAGAAATGTGTTTGGCCCT
  ATAAGGGAGAGCCCCAACAAGAACTTCCTAGTAATTGTCACAGATGGGCAGTCCTATGAT
  GATGTCCAAGGCCCTGCAGCTGCTGCACATGATGCAGGAATCACTATCTTCTCTGTTGGT
  GTGGCTTGGGCACCTCTGGATGACCTGAAAGATATGGCTTCTAAACCGAAGGAGTCTCAT
  GCTTTCTTCACAAGAGAGTTCACAGGATTAGAACCAATTGTTTCTGATGTCATCAGAGGC
  ATTTGTAGAGATTTCTTAGAATCCCAGCAATAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_004086
• Insert Size: 2100 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004086.1, NP_004077.1
• RefSeq Size: 2534 bp
• RefSeq ORF: 1653 bp
• Locus ID: 1690
• Cytogenetics: 14q12
• Domains: VWA, LCCL
• Gene Summary: 'The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate in-frame splice junction in the 5' end compared to variant 3. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1 and 2 encode the same isoform (b).