DPH3 (NM_001047434) Human Untagged Clone

CAT#: SC315392

DPH3 (untagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DPH3
• Synonyms: DELGIP; DELGIP1; DESR1; DPH3A; KTI11; ZCSL2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001047434, the custom clone sequence may differ by one or more nucleotides
  ATGGCAGTGTTTCATGACGAGGTGGAAATCGAGGACTTCCAATATGACGAGGACTCGGAG
  ACGTATTTCTATCCCTGCCCATGTGGAGATAACTTCTCCATCACCAAGGATCAGTTTGTG
  TGTGGAGAAACAGTCCCAGCCCCTTCAGCCAACAAAGAATTAGTTAAATGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001047434
• ORF Size: 174 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001047434.1, NP_001040899.1
• RefSeq Size: 583
• RefSeq ORF: 174
• Locus ID: 285381
• Gene Summary: This gene encodes a CSL zinc finger-containing protein that is required for dipthamide biosynthesis. The encoded protein is necessary for the initial step in the modification of a histidine residue in elongation factor-2 to diphthamide. This modified residue is a target for ADP ribosylation by the bacterial toxins diphtheria toxin and Pseudomonas exotoxin A. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Feb 2009]
  Transcript Variant: This variant (2) lacks an exon in the coding region but maintains the reading frame compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.