UBL5 (NM_001048241) Human Untagged Clone

CAT#: SC315393

UBL5 (untagged)-Human ubiquitin-like 5 (UBL5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBL5
• Synonyms: HUB1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001048241, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCGAGGTTGTTTGCAACGACCGTCTGGGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACCA
  TCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCCTGAAGAAGTG
  GTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTATGAAATCCACGATGGGATGAACCTGGAGCTT
  TATTATCAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001048241
• ORF Size: 222 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001048241.2, NP_001041706.1
• RefSeq Size: 469
• RefSeq ORF: 222
• Locus ID: 59286
• Gene Summary: This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.