CTXN3 (NM_001048252) Human Untagged Clone

CAT#: SC315396

CTXN3 (untagged)-Human cortexin 3 (CTXN3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTXN3
• Synonyms: KABE
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001048252 edited
  ATGGATGGAGGACAGCCCATCCCCTCATCCCTAGTCCCCCTTGGGAACGTATCAGCAGAT
  TCTAGCATGTCCCTGGAGCAGAAAATGACATTTGTTTTTGTGATTCTGTTGTTTATTTTC
  TTGGGCATTCTCATTGTCCGGTGCTTCCGGATTCTTTTGGATCCATATCGAAGCATGCCA
  ACCTCTACCTGGGCTGATGGACTTGAAGGCCTGGAGAAAGGGCAGTTCGACCATGCCCTT
  GCTTAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001048252
• ORF Size: 246 bp
• Insert Size: 1400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001048252.1, NP_001041717.1
• RefSeq Size: 1660
• RefSeq ORF: 246
• Locus ID: 613212
• Protein Families: Transmembrane