MS4A6A (NM_022349) Human Untagged Clone

CAT#: SC315408

MS4A6A (untagged)-Human membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MS4A6A
• Synonyms: 4SPAN3; 4SPAN3.2; CD20L3; CDA01; MS4A6; MST090; MSTP090
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022349, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACATCACAACCTGTTCCCAATGAGACCATCATAGTGCTCCCATCAAATGTCATCAACTTCTCCCAAG
  CAGAGAAACCCGAACCCACCAACCAGGGGCAGGATAGCCTGAAGAAACATCTACACGCAGAAATCAAAGT
  TATTGGGACTATCCAGATCTTGTGTGGCATGATGGTATTGAGCTTGGGGATCATTTTGGCATCTGCTTCC
  TTCTCTCCAAATTTTACCCAAGTGACTTCTACACTGTTGAACTCTGCTTACCCATTCATAGGACCCTTTT
  TTTTTATCATCTCTGGCTCTCTATCAATCGCCACAGAGAAAAGGTTAACCAAGCTTTTGGTGCATAGCAG
  CCTGGTTGGAAGCATTCTGAGTGCTCTGTCTGCCCTGGTGGGTTTCATTATCCTGTCTGTCAAACAGGCC
  ACCTTAAATCCTGCCTCACTGCAGTGTGAGTTGGACAAAAATAATATACCAACAAGAAGTTATGTTTCTT
  ACTTTTATCATGATTCACTTTATACCACGGACTGCTATACAGCCAAAGCCAGTCTGGCTGGAACTCTCTC
  TCTGATGCTGATTTGCACTCTGCTGGAATTCTGCCTAGCTGTGCTCACTGCTGTGCTGCGGTGGAAACAG
  GCTTACTCTGACTTCCCTGGGGTGAGTGTGCTGGCCGGCTTCACTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022349
• ORF Size: 678 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022349.3, NP_071744.2
• RefSeq Size: 1562
• RefSeq ORF: 678
• Locus ID: 64231
• Domains: CD20
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (2) is shorter on the 5' end and differs in the 3' end, compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, compared to isoform 1.