MRP6 (ABCC6) (NM_001079528) Human Untagged Clone

CAT#: SC315468

ABCC6 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABCC6
• Synonyms: ABC34; ARA; EST349056; GACI2; MLP1; MOAT-E; MOATE; MRP6; PXE; PXE1; URG7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001079528, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCGCGCCTGCTGAGCCCTGCGCGGGGCAGGGGGTCTGGAACCAGACAGAGCCTGAACCTGCCGCCA
  CCAGCCTGCTGAGCCTGTGCTTCCTGAGAACAGCAGGGGTCTGGGTACCCCCCATGTACCTCTGGGTCCT
  TGGTCCCATCTACCTCCTCTTCATCCACCACCATGGCCGGGGCTACCTCCGGATGTCCCCACTCTTCAAA
  GCCAAGATGGTAGCTGCCATCCCTGGGAGCCTGGAACCAGGCAATGTTCGGGGGAGGCAGGGGACAGGCT
  GGAACCTGGTGAAGTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001079528
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001079528.3, NP_001072996.1
• RefSeq Size: 733 bp
• RefSeq ORF: 300 bp
• Locus ID: 368
• Cytogenetics: 16p13.11
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: ABC transporters
• Gene Summary: 'The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks much of the coding region and represents a distinct 3' UTR compared to variant 1. The encoded protein (isoform 2) is much shorter and has a distinct C-terminus compared to isoform 1. The encoded protein is not a transporter, but is thought to play a role in protecting hepatocytes during chronic hepatitis B virus infection.