TAC4 (NM_001077506) Human Untagged Clone
CAT#: SC315469
TAC4 (untagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha-2
"NM_001077506" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAC4 |
Synonyms | EK; HK-1; HK1; PPT-C |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001077506, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCTTGCCTCGCCCTGCTTCTCCTGATGGAGCTGTCCGTGTGCACTGTGGCAGGT GATGGTGGAGAGGAACAGACACTCAGCACTGAAGCAGAGACCTGGGAAGGCGCTGGCCCC AGCATTCAGCTCCAGCTGCAGGAGGTGAAGACGGGCAAGGCAAGCCAGTTCTTTGGGCTG ATGGGGAAGCGAGTGGGAGGAAGACCTCTGATCCAGCCAAGGAGAAAAAAAGCATATCAG CTGGAACACACGTTCCAGGGCCTCCTGGGCAAGAGAAGCCTGTTCACAGAAGGCAGAGAG GATGAGGCCCAAGGTTCAGAG |
Restriction Sites | Please inquire |
ACCN | NM_001077506 |
ORF Size | 324 bp |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001077506.1, NP_001070974.1 |
RefSeq Size | 657 |
RefSeq ORF | 324 |
Locus ID | 255061 |
Gene Summary | This gene is a member of the tachykinin family of neurotransmitter-encoding genes. Tachykinin proteins are cleaved into small, secreted peptides that activate members of a family of receptor proteins. The products of this gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The products of this gene lack a dibasic cleavage site found in other tachykinin proteins. Consequently, the nature of the cleavage products generated in vivo remains to be determined. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (alpha-2) uses an alternate in-frame splice site in the 5' coding region, compared to variant alpha. The resulting protein (isoform alpha-2) is shorter than isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222799 | TAC4 (Myc-DDK-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha-2 |
USD 420.00 |
|
RG222799 | TAC4 (GFP-tagged) - Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha-2 |
USD 460.00 |
|
RC222799L3 | Lenti-ORF clone of TAC4 (Myc-DDK-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha-2 |
USD 620.00 |
|
RC222799L4 | Lenti-ORF clone of TAC4 (mGFP-tagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha-2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review