TNFAIP8 (NM_001077654) Human Untagged Clone

CAT#: SC315484

TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFAIP8
• Synonyms: GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001077654, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCACAGATGTCTTTAATTCCAAAAACCTGGCCGTTCAGGCACAAAAGAAGATCTTGGGTAAAATGG
  TGTCCAAATCCATCGCCACCACCTTAATAGACGACACAAGTAGTGAGGTGCTGGATGAGCTCTACAGAGT
  GACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAGAAGATCATCAAGAACCTCATCAAGACAGTCATC
  AAGCTGGCCATTCTTTATAGGAATAATCAGTTTAATCAAGATGAGCTAGCATTGATGGAGAAATTTAAGA
  AGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGTTTCCATCAGGTGGATTATACCTTTGACCGGAATGT
  GTTATCCAGGCTGTTAAATGAATGCAGAGAGATGCTGCACCAAATCATTCAGCGCCACCTCACTGCCAAG
  TCACATGGACGGGTTAATAATGTGTTTGATCATTTTTCAGATTGTGAATTTTTGGCTGCCTTGTATAATC
  CTTTTGGGAATTTTAAACCCCACTTACAAAAACTATGTGATGGTATCAACAAAATGTTGGATGAAGAGAA
  CATATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001077654
• ORF Size: 567 bp
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001077654.2, NP_001071122.1
• RefSeq Size: 2017
• RefSeq ORF: 567
• Locus ID: 25816
• Protein Families: Druggable Genome
• Gene Summary: Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate 5'-terminal exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a shorter and distinct N-terminus, compared to isoform a.