SF2 (SRSF1) (NM_001078166) Human Untagged Clone

CAT#: SC315487

SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRSF1
• Synonyms: ASF; SF2; SF2p33; SFRS1; SRp30a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001078166, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTGGGTAACTTAC
  CTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGCGCTATCCGCGACATCGACCT
  CAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGACGCG
  GTGTATGGTCGCGACGGCTATGATTACGATGGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGCCGTG
  GAACAGGCCGAGGCGGCGGCGGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCATCCAG
  GCGGTCTGAAAACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAGGATCAC
  ATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAGTTTGTAC
  GGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCATGAGGTAGGTTA
  TACACGTATTCTTTTCTTTGACCAGAATTGGATACAGTGGTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001078166
• Insert Size: 0
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001078166.1, NP_001071634.1
• RefSeq Size: 5668 bp
• RefSeq ORF: 606 bp
• Locus ID: 6426
• Cytogenetics: 17q22
• Protein Families: Stem cell - Pluripotency
• Protein Pathways: Spliceosome
• Gene Summary: 'This gene encodes a member of the arginine/serine-rich splicing factor protein family. The encoded protein can either activate or repress splicing, depending on its phosphorylation state and its interaction partners. Multiple transcript variants have been found for this gene. There is a pseudogene of this gene on chromosome 13. [provided by RefSeq, Jun 2014]'
  Transcript Variant: This variant (2) includes an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2, also known as ASF-3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.