SLC25A45 (NM_001077241) Human Untagged Clone

CAT#: SC315497

SLC25A45 (untagged)-Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2


  "NM_001077241" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC25A45"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC25A45
Synonyms AW491445; solute carrier family 25, member 45
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001077241, the custom clone sequence may differ by one or more nucleotides


ATGGTCAAGATTTACCGCCATGAGTCCCTCCTGGGCTTCTTCAAGGGAATGAGCTTCCCCATTGCCAGCA
TAGCTGTGGTCAACTCTGTCCTGTTTGGGGTCTATAGCAACACCCTGCTGGTGCTCACGGCCACCTCCCA
CCAGGAGCGGCGGGCCCAGCCGCCCAGCTACATGCACATCTTCCTAGCGGGCTGCACCGGGGGGTTCCTG
CAGGCCTACTGTCTGGCTCCTTTTGACCTCATCAAAGTCCGGCTACAAAACCAGACAGAGCCAAGGGCCC
AGCCAGGGAGCCCCCCACCCCGGTACCAGGGGCCCGTGCACTGTGCAGCCTCCATCTTCCGGGAGGAGGG
GCCCCGGGGGCTGTTCCGAGGAGCCTGGGCCCTGACGCTGAGGGACACCCCCACGGTGGGGATCTACTTC
ATCACCTATGAAGGGCTCTGTCGCCAGTACACACCAGAAGGCCAGAATCCCAGCTCAGCCACGGTGCTGG
TGGCAGGGGGCTTTGCAGGCATTGCTTCCTGGGTGGCAGCCACGCCCTTAGACGTGATCAAGTCCCGGAT
GCAGATGGATGGACTGAGACGCAGAGTGTACCAGGGGATGCTGGACTGCATGGTGAGCAGCATCCGGCAG
GAAGGACTGGGAGTCTTCTTCCGGGGGGTCACCATCAACAGTGCCCGCGCCTTTCCCGTCAATGCTGTCA
CCTTCCTCAGCTACGAATATCTCCTCCGCTGGTGGGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001077241
ORF Size 741 bp
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001077241.2, NP_001070709.2
RefSeq Size 2252
RefSeq ORF 741
Locus ID 283130
Protein Families Druggable Genome, Transmembrane
Gene Summary SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an internal exon in the 5' region which causes translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 4, and 7 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.