SLC25A45 (NM_001077241) Human Untagged Clone
CAT#: SC315497
SLC25A45 (untagged)-Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2
"NM_001077241" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC25A45 |
Synonyms | AW491445; solute carrier family 25, member 45 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001077241, the custom clone sequence may differ by one or more nucleotides
ATGGTCAAGATTTACCGCCATGAGTCCCTCCTGGGCTTCTTCAAGGGAATGAGCTTCCCCATTGCCAGCA TAGCTGTGGTCAACTCTGTCCTGTTTGGGGTCTATAGCAACACCCTGCTGGTGCTCACGGCCACCTCCCA CCAGGAGCGGCGGGCCCAGCCGCCCAGCTACATGCACATCTTCCTAGCGGGCTGCACCGGGGGGTTCCTG CAGGCCTACTGTCTGGCTCCTTTTGACCTCATCAAAGTCCGGCTACAAAACCAGACAGAGCCAAGGGCCC AGCCAGGGAGCCCCCCACCCCGGTACCAGGGGCCCGTGCACTGTGCAGCCTCCATCTTCCGGGAGGAGGG GCCCCGGGGGCTGTTCCGAGGAGCCTGGGCCCTGACGCTGAGGGACACCCCCACGGTGGGGATCTACTTC ATCACCTATGAAGGGCTCTGTCGCCAGTACACACCAGAAGGCCAGAATCCCAGCTCAGCCACGGTGCTGG TGGCAGGGGGCTTTGCAGGCATTGCTTCCTGGGTGGCAGCCACGCCCTTAGACGTGATCAAGTCCCGGAT GCAGATGGATGGACTGAGACGCAGAGTGTACCAGGGGATGCTGGACTGCATGGTGAGCAGCATCCGGCAG GAAGGACTGGGAGTCTTCTTCCGGGGGGTCACCATCAACAGTGCCCGCGCCTTTCCCGTCAATGCTGTCA CCTTCCTCAGCTACGAATATCTCCTCCGCTGGTGGGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077241 |
ORF Size | 741 bp |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001077241.2, NP_001070709.2 |
RefSeq Size | 2252 |
RefSeq ORF | 741 |
Locus ID | 283130 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (2) lacks an internal exon in the 5' region which causes translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2, 4, and 7 all encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207846 | SLC25A45 (Myc-DDK-tagged)-Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2 |
USD 98.00 |
|
RG207846 | SLC25A45 (GFP-tagged) - Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2 |
USD 460.00 |
|
RC207846L3 | Lenti ORF clone of Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC207846L4 | Lenti ORF clone of Human solute carrier family 25, member 45 (SLC25A45), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review