Kallikrein 5 (KLK5) (NM_001077491) Human Untagged Clone

CAT#: SC315511

KLK5 (untagged)-Human kallikrein-related peptidase 5 (KLK5), transcript variant 2


  "NM_001077491" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLK5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLK5
Synonyms KLK-L2; KLKL2; SCTE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001077491, the custom clone sequence may differ by one or more nucleotides


ATGGCTACAGCAAGACCCCCCTGGATGTGGGTGCTCTGTGCTCTGATCACAGCCTTGCTTCTGGGGGTCA
CAGAGCATGTTCTCGCCAACAATGATGTTTCCTGTGACCACCCCTCTAACACCGTGCCCTCTGGGAGCAA
CCAGGACCTGGGAGCTGGGGCCGGGGAAGACGCCCGGTCGGATGACAGCAGCAGCCGCATCATCAATGGA
TCCGACTGCGATATGCACACCCAGCCGTGGCAGGCCGCGCTGTTGCTAAGGCCCAACCAGCTCTACTGCG
GGGCGGTGTTGGTGCATCCACAGTGGCTGCTCACGGCCGCCCACTGCAGGAAGAAAGTTTTCAGAGTCCG
TCTCGGCCACTACTCCCTGTCACCAGTTTATGAATCTGGGCAGCAGATGTTCCAGGGGGTCAAATCCATC
CCCCACCCTGGCTACTCCCACCCTGGCCACTCTAACGACCTCATGCTCATCAAACTGAACAGAAGAATTC
GTCCCACTAAAGATGTCAGACCCATCAACGTCTCCTCTCATTGTCCCTCTGCTGGGACAAAGTGCTTGGT
GTCTGGCTGGGGGACAACCAAGAGCCCCCAAGTGCACTTCCCTAAGGTCCTCCAGTGCTTGAATATCAGC
GTGCTAAGTCAGAAAAGGTGCGAGGATGCTTACCCGAGACAGATAGATGACACCATGTTCTGCGCCGGTG
ACAAAGCAGGTAGAGACTCCTGCCAGGGTGATTCTGGGGGGCCTGTGGTCTGCAATGGCTCCCTGCAGGG
ACTCGTGTCCTGGGGAGATTACCCTTGTGCCCGGCCCAACAGACCGGGTGTCTACACGAACCTCTGCAAG
TTCACCAAGTGGATCCAGGAAACCATCCAGGCCAACTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001077491
ORF Size 882 bp
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001077491.1, NP_001070959.1
RefSeq Size 1435
RefSeq ORF 882
Locus ID 25818
Protein Families Druggable Genome, Protease, Secreted Protein, Transmembrane
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.