NUDT6 (NM_007083) Human Untagged Clone
CAT#: SC315525
NUDT6 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1
"NM_007083" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NUDT6 |
Synonyms | ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_007083, the custom clone sequence may differ by one or more nucleotides
ATGCGGCAGCCACTGAGCTGGGGCCGCTGGCGCGCGATGCTTGCCCGAACCTACGGCCCCGGGCCTTCGG CGGGTTACCGCTGGGCCTCGGGCGCACAGGGTTACGTGCGGAATCCGCCAGTTGGAGCGTGCGATCTGCA GGGCGAGCTGGACAGATTCGGGGGCATCTCGGTGCGCCTGGCGCGGCTCGATGCGCTGGACCGCCTGGAC GCTGCCGCCTTCCAGAAGGGCTTGCAGGCTGCAGTACAGCAATGGCGATCAGAAGGTAGAACAGCTGTAT GGCTGCACATTCCCATCCTCCAAAGCCGATTTATTGCCCCTGCTGCTTCCCTGGGCTTCTGCTTTCACCA CGCAGAATCGGATTCATCAACGTTGACTCTGTGGCTGAGAGAAGGGCCCAGCAGATTACCAGGATATGCT TCACATCAAGTAGGAGTTGCAGGAGCTGTATTTGATGAAAGTACTAGAAAAATACTGGTTGTACAAGATC GAAATAAATTGAAAAATATGTGGAAGTTTCCAGGAGGCCTGTCAGAGCCTGAAGAAGATATTGGAGACAC AGCGGTTCGAGAAGTTTTTGAAGAGACTGGTATAAAATCAGAATTCAGGTCCGTCCTGAGTATTCGGCAA CAGCACACAAATCCTGGAGCTTTTGGGAAGTCAGATATGTATATCATCTGCCGCCTAAAGCCATATTCAT TCACCATAAATTTTTGCCAGGAAGAATGCTTAAGATGTGAGTGGATGGATCTCAATGACCTGGCGAAGAC TGAAAATACAACTCCCATCACCAGCAGAGTTGCTAGGCTGCTGCTGTATGGGTACAGAGAAGGGTTTGAC AAAATTGACCTGACTGTGGAAGAACTTCCAGCAGTTTACACAGGACTGTTTTATAAACTCTATCATAAGG AACTGCCAGAGAATTATAAAACTATGAAAGGAATTGATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007083 |
ORF Size | 951 bp |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_007083.4, NP_009014.2 |
RefSeq Size | 1197 |
RefSeq ORF | 951 |
Locus ID | 11162 |
Domains | NUDIX |
Gene Summary | This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203470 | NUDT6 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1 |
USD 420.00 |
|
RG203470 | NUDT6 (GFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1 |
USD 460.00 |
|
RC203470L1 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC203470L2 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC203470L3 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC203470L4 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review