NUDT6 (NM_007083) Human Untagged Clone

CAT#: SC315525

NUDT6 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1


  "NM_007083" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NUDT6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NUDT6
Synonyms ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_007083, the custom clone sequence may differ by one or more nucleotides


ATGCGGCAGCCACTGAGCTGGGGCCGCTGGCGCGCGATGCTTGCCCGAACCTACGGCCCCGGGCCTTCGG
CGGGTTACCGCTGGGCCTCGGGCGCACAGGGTTACGTGCGGAATCCGCCAGTTGGAGCGTGCGATCTGCA
GGGCGAGCTGGACAGATTCGGGGGCATCTCGGTGCGCCTGGCGCGGCTCGATGCGCTGGACCGCCTGGAC
GCTGCCGCCTTCCAGAAGGGCTTGCAGGCTGCAGTACAGCAATGGCGATCAGAAGGTAGAACAGCTGTAT
GGCTGCACATTCCCATCCTCCAAAGCCGATTTATTGCCCCTGCTGCTTCCCTGGGCTTCTGCTTTCACCA
CGCAGAATCGGATTCATCAACGTTGACTCTGTGGCTGAGAGAAGGGCCCAGCAGATTACCAGGATATGCT
TCACATCAAGTAGGAGTTGCAGGAGCTGTATTTGATGAAAGTACTAGAAAAATACTGGTTGTACAAGATC
GAAATAAATTGAAAAATATGTGGAAGTTTCCAGGAGGCCTGTCAGAGCCTGAAGAAGATATTGGAGACAC
AGCGGTTCGAGAAGTTTTTGAAGAGACTGGTATAAAATCAGAATTCAGGTCCGTCCTGAGTATTCGGCAA
CAGCACACAAATCCTGGAGCTTTTGGGAAGTCAGATATGTATATCATCTGCCGCCTAAAGCCATATTCAT
TCACCATAAATTTTTGCCAGGAAGAATGCTTAAGATGTGAGTGGATGGATCTCAATGACCTGGCGAAGAC
TGAAAATACAACTCCCATCACCAGCAGAGTTGCTAGGCTGCTGCTGTATGGGTACAGAGAAGGGTTTGAC
AAAATTGACCTGACTGTGGAAGAACTTCCAGCAGTTTACACAGGACTGTTTTATAAACTCTATCATAAGG
AACTGCCAGAGAATTATAAAACTATGAAAGGAATTGATTAA


Restriction Sites SgfI-MluI     
ACCN NM_007083
ORF Size 951 bp
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_007083.4, NP_009014.2
RefSeq Size 1197
RefSeq ORF 951
Locus ID 11162
Domains NUDIX
Gene Summary This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.