GPBAR1 (NM_001077194) Human Untagged Clone

CAT#: SC315529

GPBAR1 (untagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2


  "NM_001077194" in other vectors (4)

Reconstitution Protocol

USD 660.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "GPBAR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GPBAR1
Synonyms BG37; GPCR19; GPR131; M-BAR; TGR5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001077194, the custom clone sequence may differ by one or more nucleotides


ATGACGCCCAACAGCACTGGCGAGGTGCCCAGCCCCATTCCCAAGGGGGCTTTGGGGCTCTCCCTGGCCC
TGGCAAGCCTCATCATCACCGCGAACCTGCTCCTAGCCCTGGGCATCGCCTGGGACCGCCGCCTGCGCAG
CCCACCTGCTGGCTGCTTCTTCCTGAGCCTACTGCTGGCTGGGCTGCTCACGGGTCTGGCATTGCCCACA
TTGCCAGGGCTGTGGAACCAGAGTCGCCGGGGTTACTGGTCCTGCCTCCTCGTCTACTTGGCTCCCAACT
TCTCCTTCCTCTCCCTGCTTGCCAACCTCTTGCTGGTGCACGGGGAGCGCTACATGGCAGTCCTGAGGCC
ACTCCAGCCCCCTGGGAGCATTCGGCTGGCCCTGCTCCTCACCTGGGCTGGTCCCCTGCTCTTTGCCAGT
CTGCCCGCTCTGGGGTGGAACCACTGGACCCCTGGTGCCAACTGCAGCTCCCAGGCTATCTTCCCAGCCC
CCTACCTGTACCTCGAAGTCTATGGGCTCCTGCTGCCCGCCGTGGGTGCTGCTGCCTTCCTCTCTGTCCG
CGTGCTGGCCACTGCCCACCGCCAGCTGCAGGACATCTGCCGGCTGGAGCGGGCAGTGTGCCGCGATGAG
CCCTCCGCCCTGGCCCGGGCCCTTACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCG
GGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACT
GGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATG
GGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGG
GAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCT
GGACTTGAACTAA


Restriction Sites ECoRI-NOT     
ACCN NM_001077194
ORF Size 993 bp
Insert Size 1400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001077194.1.
Reference Data
RefSeq NM_001077194.1, NP_001070662.1
RefSeq Size 1515
RefSeq ORF 993
Locus ID 151306
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.