Constitutive androstane receptor (NR1I3) (NM_001077469) Human Untagged Clone
CAT#: SC315535
NR1I3 (untagged)-Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6
"NM_001077469" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NR1I3 |
Synonyms | CAR; CAR1; MB67 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001077469 edited
TCATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAG GCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCA GCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGA GGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACA TGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCAC AGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGG CCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTC ATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACAC ACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGC CTGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGG AAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCG GGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTGGGGTTCCAGGTAGAGTTTTTGG AGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATG TGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCTGGAG TTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCT ACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGCTCACCTGGAACACCCTGGATACACT GGAGTGGGAAAATGCTGGGACCAAAGATTGGGCCGGGTTCAAAGGGAGCCCAGTGGTTGC AATGA |
Restriction Sites | Please inquire |
ACCN | NM_001077469 |
ORF Size | 1023 bp |
Insert Size | 1000 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match the protein associated with NM_001077469.1. |
Reference Data | |
RefSeq | NM_001077469.1, NP_001070937.1 |
RefSeq Size | 1242 |
RefSeq ORF | 1023 |
Locus ID | 9970 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6), also known as SV-1, uses two alternate splice sites in the 3' coding region, compared to variant 1. The resulting protein (isoform 6) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216643 | NR1I3 (Myc-DDK-tagged)-Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6 |
USD 420.00 |
|
RG216643 | NR1I3 (GFP-tagged) - Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6 |
USD 460.00 |
|
RC216643L3 | Lenti ORF clone of Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC216643L4 | Lenti ORF clone of Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review