Constitutive androstane receptor (NR1I3) (NM_001077469) Human Untagged Clone

CAT#: SC315535

NR1I3 (untagged)-Human nuclear receptor subfamily 1, group I, member 3 (NR1I3), transcript variant 6


  "NM_001077469" in other vectors (4)

Reconstitution Protocol

USD 580.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NR1I3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NR1I3
Synonyms CAR; CAR1; MB67
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001077469 edited
TCATGGCCAGTAGGGAAGATGAGCTGAGGAACTGTGTGGTATGTGGGGACCAAGCCACAG
GCTACCACTTTAATGCGCTGACTTGTGAGGGCTGCAAGGGTTTCTTCAGGAGAACAGTCA
GCAAAAGCATTGGTCCCACCTGCCCCTTTGCTGGAAGCTGTGAAGTCAGCAAGACTCAGA
GGCGCCACTGCCCAGCCTGCAGGTTGCAGAAGTGCTTAGATGCTGGCATGAGGAAAGACA
TGATACTGTCGGCAGAAGCCCTGGCATTGCGGCGAGCAAAGCAGGCCCAGCGGCGGGCAC
AGCAAACACCTGTGCAACTGAGTAAGGAGCAAGAAGAGCTGATCCGGACACTCCTGGGGG
CCCACACCCGCCACATGGGCACCATGTTTGAACAGTTTGTGCAGTTTAGGCCTCCAGCTC
ATCTGTTCATCCATCACCAGCCCTTGCCCACCCTGGCCCCTGTGCTGCCTCTGGTCACAC
ACTTCGCAGACATCAACACTTTCATGGTACTGCAAGTCATCAAGTTTACTAAGGACCTGC
CTGTCTTCCGTTCCCTGCCCATTGAAGACCAGATCTCCCTTCTCAAGGGAGCAGCTGTGG
AAATCTGTCACATCGTACTCAATACCACTTTCTGTCTCCAAACACAAAACTTCCTCTGCG
GGCCTCTTCGCTACACAATTGAAGATGGAGCCCGTGTGGGGTTCCAGGTAGAGTTTTTGG
AGTTGCTCTTTCACTTCCATGGAACACTACGAAAACTGCAGCTCCAAGAGCCTGAGTATG
TGCTCTTGGCTGCCATGGCCCTCTTCTCTCCTGCTCCCTATCTTACAGACCGACCTGGAG
TTACCCAGAGAGATGAGATTGATCAGCTGCAAGAGGAGATGGCACTGACTCTGCAAAGCT
ACATCAAGGGCCAGCAGCGAAGGCCCCGGGATCGCTCACCTGGAACACCCTGGATACACT
GGAGTGGGAAAATGCTGGGACCAAAGATTGGGCCGGGTTCAAAGGGAGCCCAGTGGTTGC
AATGA
Restriction Sites Please inquire     
ACCN NM_001077469
ORF Size 1023 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match the protein associated with NM_001077469.1.
Reference Data
RefSeq NM_001077469.1, NP_001070937.1
RefSeq Size 1242
RefSeq ORF 1023
Locus ID 9970
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Gene Summary This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6), also known as SV-1, uses two alternate splice sites in the 3' coding region, compared to variant 1. The resulting protein (isoform 6) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.