MCL1 (NM_021960) Human Untagged Clone

CAT#: SC315538

MCL1 (untagged)-Human myeloid cell leukemia sequence 1 (BCL2-related) (MCL1), nuclear gene encoding mitochondrial protein, transcript variant 1


  "NM_021960" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MCL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MCL1
Synonyms bcl2-L-3; BCL2L3; EAT; Mcl-1; MCL1-ES; mcl1/EAT; MCL1L; MCL1S; TM
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_021960 edited
ATGTTTGGCCTCAAAAGAAACGCGGTAATCGGACTCAACCTCTACTGTGGGGGGGCCGGC
TTGGGGGCCGGCAGCGGCGGCGCCACCCGCCCGGGAGGGCGACTTTTGGCTACGGAGAAG
GAGGCCTCGGCCCGGCGAGAGATAGGGGGAGGGGAGGCCGGCGCGGTGATTGGCGGAAGC
GCCGGCGCAAGCCCCCCGTCCACCCTCACGCCAGACTCCCGGAGGGTCGCGCGGCCGCCG
CCCATTGGCGCCGAGGTCCCCGACGTCACCGCGACCCCCGCGAGGCTGCTTTTCTTCGCG
CCCACCCGCCGCGCGGCGCCGCTTGAGGAGATGGAAGCCCCGGCCGCTGACGCCATCATG
TCGCCCGAAGAGGAGCTGGACGGGTACGAGCCGGAGCCTCTCGGGAAGCGGCCGGCTGTC
CTGCCGCTGCTGGAGTTGGTCGGGGAATCTGGTAATAACACCAGTACGGACGGGTCACTA
CCCTCGACGCCGCCGCCAGCAGAGGAGGAGGAGGACGAGTTGTACCGGCAGTCGCTGGAG
ATTATCTCTCGGTACCTTCGGGAGCAGGCCACCGGCGCCAAGGACACAAAGCCAATGGGC
AGGTCTGGGGCCACCAGCAGGAAGGCGCTGGAGACCTTACGACGGGTTGGGGATGGCGTG
CAGCGCAACCACGAGACGGCCTTCCAAGGCATGCTTCGGAAACTGGACATCAAAAACGAA
GACGATGTGAAATCGTTGTCTCGAGTGATGATCCATGTTTTCAGCGACGGCGTAACAAAC
TGGGGCAGGATTGTGACTCTCATTTCTTTTGGTGCCTTTGTGGCTAAACACTTGAAGACC
ATAAACCAAGAAAGCTGCATCGAACCATTAGCAGAAAGTATCACAGACGTTCTCGTAAGG
ACAAAACGGGACTGGCTAGTTAAACAAAGAGGCTGGGATGGGTTTGTGGAGTTCTTCCAT
GTAGAGGACCTAGAAGGTGGCATCAGGAATGTGCTGCTGGCTTTTGCAGGTGTTGCTGGA
GTAGGAGCTGGTTTGGCATATCTAATAAGATAG
Restriction Sites NotI-NotI     
ACCN NM_021960
Insert Size 2400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021960.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021960.3, NP_068779.1
RefSeq Size 4020 bp
RefSeq ORF 1053 bp
Locus ID 4170
Cytogenetics 1q21.2
Domains Bcl-2
Protein Families Druggable Genome, Transmembrane
Gene Summary 'This gene encodes an anti-apoptotic protein, which is a member of the Bcl-2 family. Alternative splicing results in multiple transcript variants. The longest gene product (isoform 1) enhances cell survival by inhibiting apoptosis while the alternatively spliced shorter gene products (isoform 2 and isoform 3) promote apoptosis and are death-inducing. [provided by RefSeq, Oct 2010]'
Transcript Variant: This variant (1), also known as MCL-1L (long), represents the longest transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.