GRIA4 (NM_001077244) Human Untagged Clone

CAT#: SC315555

GRIA4 (untagged)-Human glutamate receptor, ionotrophic, AMPA 4 (GRIA4), transcript variant 3


  "NM_001077244" in other vectors (4)

Reconstitution Protocol

USD 730.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GRIA4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRIA4
Synonyms GluA4; GLUR4; GLUR4C; GLURD; NEDSGA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001077244, the custom clone sequence may differ by one or more nucleotides


ATGAGGATTATTTCCAGACAGATTGTCTTGTTATTTTCTGGATTTTGGGGACTCGCCATGGGAGCCTTTC
CGAGCAGCGTGCAAATAGGTGGTCTCTTCATCCGAAACACAGATCAGGAATACACTGCTTTTCGATTAGC
AATTTTTCTTCATAACACCAGCCCCAATGCGTCGGAAGCTCCTTTTAATTTGGTACCTCATGTGGACAAC
ATTGAGACAGCCAACAGTTTTGCTGTAACAAACGCCTTCTGTTCCCAGTATTCTAGAGGAGTATTTGCCA
TTTTTGGACTCTATGATAAGAGGTCGGTACATACCTTGACCTCATTCTGCAGCGCCTTACATATCTCCCT
CATCACACCAAGTTTCCCTACTGAGGGGGAGAGCCAGTTTGTGCTGCAACTAAGACCTTCGTTACGAGGA
GCACTCTTGAGTTTGCTGGATCACTACGAATGGAACTGTTTTGTCTTCCTGTATGACACAGACAGGGGAT
ACTCGATACTCCAAGCTATTATGGAAAAAGCAGGACAAAATGGTTGGCATGTCAGCGCTATATGTGTGGA
AAATTTTAATGATGTCAGCTATAGGCAACTTCTAGAAGAACTTGACAGAAGACAAGAGAAGAAGTTTGTA
ATAGACTGTGAGATAGAGAGACTTCAAAACATATTAGAACAGATTGTAAGTGTTGGAAAGCATGTTAAAG
GCTACCATTATATCATTGCAAACTTGGGATTCAAGGATATTTCTCTTGAGAGGTTTATACATGGTGGAGC
CAATGTTACTGGATTCCAGTTGGTGGATTTTAATACACCTATGGTAATCAAACTAATGGATCGCTGGAAG
AAACTAGATCAGAGAGAGTATCCAGGATCTGAGACTCCTCCAAAGTACACCTCTGCTCTGACTTATGATG
GAGTCCTTGTGATGGCTGAAACTTTCCGAAGTCTTAGGAGGCAGAAAATTGATATCTCAAGGAGAGGAAA
TGCTGGGGATTGTCTGGCAAATCCTGCTGCTCCATGGGGCCAGGGAATTGACATGGAGAGGACACTCAAA
CAGGTTCGAATTCAAGGGCTGACAGGGAATGTTCAGTTTGACCACTATGGACGTAGAGTCAATTACACAA
TGGATGTGTTTGAGCTGAAAAGCACAGGACCTAGAAAGGTTGGTTACTGGAATGATATGGATAAGTTAGT
CTTGATTCAAGATGTACCAACTCTTGGCAATGACACAGCTGCTATTGAGAACAGAACAGTGGTTGTAACC
ACAATTATGCCTCTGATGAAGAATCCTATTTTAAGAAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001077244
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001077244.1, NP_001070712.1
RefSeq Size 3345 bp
RefSeq ORF 1302 bp
Locus ID 2893
Cytogenetics 11q22.3
Protein Families Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. Some haplotypes of this gene show a positive association with schizophrenia. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) is missing several coding exons at the 3' end, and contains a novel 3' terminal exon compared to transcript variant 1. This results in a shorter isoform (3) with a different C-terminus compared to isoform 1. Variants 3 and 4 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.