ENT1 (SLC29A1) (NM_001078174) Human Untagged Clone

CAT#: SC315560

SLC29A1 (untagged)-Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 4


  "NM_001078174" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC29A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC29A1
Synonyms ENT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001078174, the custom clone sequence may differ by one or more nucleotides


ATGACAACCAGTCACCAGCCTCAGGACAGATACAAAGCTGTCTGGCTTATCTTCTTCATGCTGGGTCTGG
GAACGCTGCTCCCGTGGAATTTTTTCATGACGGCCACTCAGTATTTCACAAACCGCCTGGACATGTCCCA
GAATGTGTCCTTGGTCACTGCTGAACTGAGCAAGGACGCCCAGGCGTCAGCCGCCCCTGCAGCACCCTTG
CCTGAGCGGAACTCTCTCAGTGCCATCTTCAACAATGTCATGACCCTATGTGCCATGCTGCCCCTGCTGT
TATTCACCTACCTCAACTCCTTCCTGCATCAGAGGATCCCCCAGTCCGTACGGATCCTGGGCAGCCTGGT
GGCCATCCTGCTGGTGTTTCTGATCACTGCCATCCTGGTGAAGGTGCAGCTGGATGCTCTGCCCTTCTTT
GTCATCACCATGATCAAGATCGTGCTCATTAATTCATTTGGTGCCATCCTGCAGGGCAGCCTGTTTGGTC
TGGCTGGCCTTCTGCCTGCCAGCTACACGGCCCCCATCATGAGTGGCCAGGGCCTAGCAGGCTTCTTTGC
CTCCGTGGCCATGATCTGCGCTATTGCCAGTGGCTCGGAGCTATCAGAAAGTGCCTTCGGCTACTTTATC
ACAGCCTGTGCTGTTATCATTTTGACCATCATCTGTTACCTGGGCCTGCCCCGCCTGGAATTCTACCGCT
ACTACCAGCAGCTCAAGCTTGAAGGACCCGGGGAGCAGGAGACCAAGTTGGACCTCATTAGCAAAGGAGA
GGAGCCAAGAGCAGGCAAAGAGGAATCTGGAGTTTCAGTCTCCAACTCTCAGCCCACCAATGAAAGCCAC
TCTATCAAAGCCATCCTGAAAAATATCTCAGTCCTGGCTTTCTCTGTCTGCTTCATCTTCACTATCACCA
TTGGGATGTTTCCAGCCGTGACTGTTGAGGTCAAGTCCAGCATCGCAGGCAGCAGCACCTGGGAACGTTA
CTTCATTCCTGTGTCCTGTTTCTTGACTTTCAATATCTTTGACTGGTTGGGCCGGAGCCTCACAGCTGTA
TTCATGTGGCCTGGGAAGGACAGCCGCTGGCTGCCAAGCCTGGTGCTGGCCCGGCTGGTGTTTGTGCCAC
TGCTGCTGCTGTGCAACATTAAGCCCCGCCGCTACCTGACTGTGGTCTTCGAGCACGATGCCTGGTTCAT
CTTCTTCATGGCTGCCTTTGCCTTCTCCAACGGCTACCTCGCCAGCCTCTGCATGTGCTTCGGGCCCAAG
AAAGTGAAGCCAGCTGAGGCAGAGACCGCAGGAGCCATCATGGCCTTCTTCCTGTGTCTGGGTCTGGCAC
TGGGGGCTGTTTTCTCCTTCCTGTTCCGGGCAATTGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001078174
Insert Size 0
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001078174.1, NP_001071642.1
RefSeq Size 2344 bp
RefSeq ORF 1371 bp
Locus ID 2030
Cytogenetics 6p21.1
Protein Families Transmembrane
Gene Summary 'This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. There is an upstream in-frame AUG at nt 255-257. This AUG is not annotated because it has a weak Kozak signal and N-terminal sequencing (PMID 8986748) identified the downstream annotated AUG as the translation start. Variants 1, 2, 3, 4, and 5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.