ENT1 (SLC29A1) (NM_001078176) Human Untagged Clone
CAT#: SC315562
SLC29A1 (untagged)-Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 3
"NM_001078176" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC29A1 |
Synonyms | ENT1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001078176, the custom clone sequence may differ by one or more nucleotides
ATGACAACCAGTCACCAGCCTCAGGACAGATACAAAGCTGTCTGGCTTATCTTCTTCATGCTGGGTCTGG GAACGCTGCTCCCGTGGAATTTTTTCATGACGGCCACTCAGTATTTCACAAACCGCCTGGACATGTCCCA GAATGTGTCCTTGGTCACTGCTGAACTGAGCAAGGACGCCCAGGCGTCAGCCGCCCCTGCAGCACCCTTG CCTGAGCGGAACTCTCTCAGTGCCATCTTCAACAATGTCATGACCCTATGTGCCATGCTGCCCCTGCTGT TATTCACCTACCTCAACTCCTTCCTGCATCAGAGGATCCCCCAGTCCGTACGGATCCTGGGCAGCCTGGT GGCCATCCTGCTGGTGTTTCTGATCACTGCCATCCTGGTGAAGGTGCAGCTGGATGCTCTGCCCTTCTTT GTCATCACCATGATCAAGATCGTGCTCATTAATTCATTTGGTGCCATCCTGCAGGGCAGCCTGTTTGGTC TGGCTGGCCTTCTGCCTGCCAGCTACACGGCCCCCATCATGAGTGGCCAGGGCCTAGCAGGCTTCTTTGC CTCCGTGGCCATGATCTGCGCTATTGCCAGTGGCTCGGAGCTATCAGAAAGTGCCTTCGGCTACTTTATC ACAGCCTGTGCTGTTATCATTTTGACCATCATCTGTTACCTGGGCCTGCCCCGCCTGGAATTCTACCGCT ACTACCAGCAGCTCAAGCTTGAAGGACCCGGGGAGCAGGAGACCAAGTTGGACCTCATTAGCAAAGGAGA GGAGCCAAGAGCAGGCAAAGAGGAATCTGGAGTTTCAGTCTCCAACTCTCAGCCCACCAATGAAAGCCAC TCTATCAAAGCCATCCTGAAAAATATCTCAGTCCTGGCTTTCTCTGTCTGCTTCATCTTCACTATCACCA TTGGGATGTTTCCAGCCGTGACTGTTGAGGTCAAGTCCAGCATCGCAGGCAGCAGCACCTGGGAACGTTA CTTCATTCCTGTGTCCTGTTTCTTGACTTTCAATATCTTTGACTGGTTGGGCCGGAGCCTCACAGCTGTA TTCATGTGGCCTGGGAAGGACAGCCGCTGGCTGCCAAGCCTGGTGCTGGCCCGGCTGGTGTTTGTGCCAC TGCTGCTGCTGTGCAACATTAAGCCCCGCCGCTACCTGACTGTGGTCTTCGAGCACGATGCCTGGTTCAT CTTCTTCATGGCTGCCTTTGCCTTCTCCAACGGCTACCTCGCCAGCCTCTGCATGTGCTTCGGGCCCAAG AAAGTGAAGCCAGCTGAGGCAGAGACCGCAGGAGCCATCATGGCCTTCTTCCTGTGTCTGGGTCTGGCAC TGGGGGCTGTTTTCTCCTTCCTGTTCCGGGCAATTGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001078176 |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001078176.2, NP_001071644.1 |
RefSeq Size | 2201 bp |
RefSeq ORF | 1371 bp |
Locus ID | 2030 |
Cytogenetics | 6p21.1 |
Protein Families | Transmembrane |
Gene Summary | 'This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. This variant has an upstream in-frame AUG at nt 64-66. This AUG is not annotated because it has a weak Kozak signal and N-terminal sequencing (PMID 8986748) identified the downstream annotated AUG as the translation start. Variants 1, 2, 3, 4, and 5 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224498 | SLC29A1 (Myc-DDK-tagged)-Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 480.00 |
|
RG224498 | SLC29A1 (GFP-tagged) - Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 530.00 |
|
RC224498L3 | Lenti ORF clone of Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
USD 680.00 |
|
RC224498L4 | Lenti ORF clone of Human solute carrier family 29 (nucleoside transporters), member 1 (SLC29A1), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review