WIPF1 (NM_001077269) Human Untagged Clone
CAT#: SC315577
WIPF1 (untagged)-Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2
"NM_001077269" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WIPF1 |
Synonyms | PRPL-2; WAS2; WASPIP; WIP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001077269, the custom clone sequence may differ by one or more nucleotides
ATGCCTGTCCCTCCCCCTCCAGCACCCCCGCCGCCCCCGACGTTTGCACTGGCCAATACAGAGAAGCCTA CCTTGAATAAGACAGAGCAGGCTGGGAGAAATGCTCTCCTTTCTGATATCAGCAAAGGGAAGAAACTAAA GAAGACGGTCACCAATGACAGAAGTGCACCAATACTGGACAAACCTAAAGGAGCTGGTGCTGGAGGCGGT GGTGGTGGCTTTGGTGGAGGCGGCGGATTTGGCGGAGGAGGTGGTGGCGGAGGCGGTGGAAGTTTTGGAG GGGGCGGACCTCCAGGTCTGGGAGGATTGTTCCAGGCTGGAATGCCGAAGCTGAGATCCACGGCCAACAG GGATAATGATTCTGGAGGAAGCCGACCACCATTGTTGCCACCGGGAGGAAGATCCACATCTGCGAAACCC TTTTCACCCCCAAGTGGCCCAGGGAGGTTTCCTGTGCCTTCTCCAGGCCACAGAAGTGGTCCCCCAGAGC CTCAGAGGAACCGAATGCCGCCCCCAAGGCCCGACGTGGGCTCAAAGCCTGATAGCATTCCTCCTCCAGT ACCTAGTACTCCAAGACCCATTCAATCAAGTCCGCACAACCGGGGGTCCCCACCAGTGCCCGGAGGCCCC AGGCAGCCCAGCCCCGGGCCCACTCCTCCCCCTTTCCCTGGAAACCGCGGCACTGCTTTGGGAGGAGGCT CAATACGTCAGTCCCCCTTGAGCTCCTCCTCGCCCTTCTCCAACCGGCCTCCCCTGCCGCCTACCCCCAG CAGGGCCTTGGATGACAAACCCCCTCCACCACCTCCTCCAGTGGGCAACAGGCCCTCCATCCACAGGGAA GCGGTTCCCCCTCCTCCTCCTCAGAACAACAAGCCTCCAGTGCCTTCCACTCCGCGGCCTTCGGCCTCCT CACAGGCCCCACCTCCGCCGCCACCTCCCAGCAGGCCCGGGCCGCCTCCTCTGCCTCCAAGTTCCAGCGG CAATGACGAAACCCCAAGACTCCCACAGCGGAATCTGTCCCTCAGTTCGTCCACGCCCCCGTTACCTTCG CCAGGACGTTCAGGTCCTCTTCCTCCCCCGCCCAGTGAGAGACCCCCACCTCCAGTGAGGGACCCGCCAG GCCGATCAGGCCCCCTCCCACCACCTCCTCCAGTAAGCAGAAACGGCAGCACATCTCGGGCCCTGCCTGC TACCCCTCAGTTGCCATCCAGGAGTGGAGTAGACAGTCCCAGGAGTGGACCCAGGCCTCCCCTTCCTCCT GATAGGCCCAGTGCTGGGGCACCTCCCCCACCTCCACCATCAACATCTATTAGAAATGGCTTCCAAGACT CTCCATGTGAAGATGAGTGGGAAAGCAGATTCTACTTCCATCCGATTTCCGATTTGCCACCTCCAGAGCC ATATGTACAAACGACCAAAAGTTATCCCAGCAAACTGGCAAGAAACGAAAGCCGGAGTGGATCCAACCGA AGAGAAAGGGGTGCTCCACCACTCCCTCCCATCCCGAGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001077269 |
Insert Size | 0 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001077269.1, NP_001070737.1 |
RefSeq Size | 4664 bp |
RefSeq ORF | 1512 bp |
Locus ID | 7456 |
Cytogenetics | 2q31.1 |
Gene Summary | 'This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212019 | WIPF1 (Myc-DDK-tagged)-Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2 |
USD 470.00 |
|
RG212019 | WIPF1 (GFP-tagged) - Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2 |
USD 520.00 |
|
RC212019L1 | Lenti ORF clone of Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2, Myc-DDK-tagged |
USD 828.00 |
|
RC212019L2 | Lenti ORF clone of Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2, mGFP tagged |
USD 670.00 |
|
RC212019L3 | Lenti ORF clone of Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2, Myc-DDK-tagged |
USD 670.00 |
|
RC212019L4 | Lenti ORF clone of Human WAS/WASL interacting protein family, member 1 (WIPF1), transcript variant 2, mGFP tagged |
USD 670.00 |
{0} Product Review(s)
Be the first one to submit a review