PPP1R1C (NM_001080545) Human Untagged Clone

CAT#: SC315666

PPP1R1C (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R1C
• Synonyms: IPP5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001080545, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAAG
  CAGCAGAGCAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTGATTCTCAATGAGCATAACCCCCC
  AGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAGAATGCATCCCCTAAGCAAAGGAAG
  CAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTGAAAGGCCAGAATGAATCAGCATTCC
  CTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGACCATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080545
• ORF Size: 330 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001080545.2, NP_001074014.1
• RefSeq Size: 1078
• RefSeq ORF: 330
• Locus ID: 151242
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]). [supplied by OMIM, Feb 2010]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region and differs in the 3' UTR compared to variant 1. The resulting protein is shorter compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.