Prion protein PrP (PRNP) (NM_001080121) Human Untagged Clone

CAT#: SC315705

PRNP (untagged)-Human prion protein (PRNP), transcript variant 3


  "NM_001080121" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRNP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRNP
Synonyms AltPrP; ASCR; CD230; CJD; GSS; KURU; p27-30; PRIP; PrP; PrP27-30; PrP33-35C; PrPc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001080121, the custom clone sequence may differ by one or more nucleotides


ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGA
AGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAA
CCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGT
GGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGAGGTG
GCACCCACAGTCAGTGGAACAAGCCGAGTAAGCCAAAAACCAACATGAAGCACATGGCTGGTGCTGCAGC
AGCTGGGGCAGTGGTGGGGGGCCTTGGCGGCTACATGCTGGGAAGTGCCATGAGCAGGCCCATCATACAT
TTCGGCAGTGACTATGAGGACCGTTACTATCGTGAAAACATGCACCGTTACCCCAACCAAGTGTACTACA
GGCCCATGGATGAGTACAGCAACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCA
CACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTT
GAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCC
TCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001080121
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080121.1, NP_001073590.1
RefSeq Size 2750 bp
RefSeq ORF 762 bp
Locus ID 5621
Cytogenetics 20p13
Protein Families ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane
Protein Pathways Prion diseases
Gene Summary 'The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]'
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-5 can all encode the same protein (Prp).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.