PACRG (NM_001080378) Human Untagged Clone

CAT#: SC315709

PACRG (untagged)-Human PARK2 co-regulated (PACRG), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PACRG
• Synonyms: GLUP; HAK005771; PACRG2.1; PARK2CRG
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001080378, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGGCAGAAAAAGAGACCCTGAGCTTAAACAAATGCCCAGACAAGATGCCGAAGAGGACCAAGCTGC
  TGGCACAACAGCCGCTCCCGGTGCACCAGCCTCACTCTCTGGTTTCTGAGGGTTTCACAGTCAAAGCCAT
  GATGAAAAACTCAGTCGTGAGAGGCCCTCCAGCTGCAGGGGCATTTAAAGAAAGACCAACCAAGCCCACA
  GCATTTCGAAAATTCTATGAGCGAGGTGACTTCCCAATTGCCCTTGAGCATGATTCGAAAGGAAACAAAA
  TCGCCTGGAAGGTAGAAATTGAGAAGCTGGATTACCATCATTATCTGCCTCTGTTTTTTGATGGGCTTTG
  TGAAATGACATTTCCCTATGAGTTTTTTGCTCGGCAAGGAATCCACGACATGCTGGAACACGGTGGGAAC
  AAGATCCTACCTGTCCTTCCACAGCTCATTATCCCGATAAAAAATGCCTTGAACCTCCGAAACCGACAGG
  TCATCTGTGTCACTCTCAAGGTCCTCCAGCATCTGGTTGTGTCAGCTGAGATGGTGGGCAAGGCCTTGGT
  GCCTTATTACCGTCAAATCCTCCCTGTCCTGAACATCTTTAAGAATATGAATGTGAACTCCGGAGACGGC
  ATTGACTACAGCCAGCAGAAGAGGGAGAACATTGGGGACTTGATCCAGGAGACACTGGAGGCCTTCGAGC
  GCTACGGAGGAGAAAATGCCTTTATCAACATTAAGTACGTGGTCCCAACCTACGAGTCTTGCTTGCTAAA
  CTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001080378
• ORF Size: 774 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001080378.1, NP_001073847.1
• RefSeq Size: 1585
• RefSeq ORF: 774
• Locus ID: 135138
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinson's disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinson's disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Both variants 2 and 3 encode the same isoform.