JNK3 (MAPK10) (NM_138980) Human Untagged Clone

CAT#: SC315755

MAPK10 (untagged)-Human mitogen-activated protein kinase 10 (MAPK10), transcript variant 3


  "NM_138980" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAPK10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAPK10
Synonyms JNK3; JNK3A; p54bSAPK; p493F12; PRKM10; SAPK1b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138980, the custom clone sequence may differ by one or more nucleotides


ATGAGCAAAAGCAAAGTTGACAACCAGTTCTACAGTGTGGAAGTGGGAGACTCAACCTTCACAGTTCTCA
AGCGCTACCAGAATCTAAAGCCTATTGGCTCTGGGGCTCAGGGCATAGTTTGTGCCGCGTATGATGCTGT
CCTTGACAGAAATGTGGCCATTAAGAAGCTCAGCAGACCCTTTCAGAACCAAACACATGCCAAGAGAGCG
TACCGGGAGCTGGTCCTCATGAAGTGTGTGAACCATAAAAACATTATTAGTTTATTAAATGTCTTCACAC
CCCAGAAAACGCTGGAGGAGTTCCAAGATGTTTACTTAGTAATGGAACTGATGGATGCCAACTTATGTCA
AGTGATTCAGATGGAATTAGACCATGAGCGAATGTCTTACCTGCTGTACCAAATGTTGTGTGGCATTAAG
CACCTCCATTCTGCTGGAATTATTCACAGGGATTTAAAACCAAGTAACATTGTAGTCAAGTCTGATTGCA
CATTGAAAATCCTGGACTTTGGACTGGCCAGGACAGCAGGCACAAGCTTCATGATGACTCCATATGTGGT
GACACGTTATTACAGAGCCCCTGAGGTCATCCTGGGGATGGGCTACAAGGAGAACGTGGATATATGGTCT
GTGGGATGCATTATGGGAGAAATGGTTCGCCACAAAATCCTCTTTCCAGGAAGGGACTATATTGACCAGT
GGAATAAGGTAATTGAACAACTAGGAACACCATGTCCAGAATTCATGAAGAAATTGCAACCCACAGTAAG
AAACTATGTGGAGAATCGGCCCAAGTATGCGGGACTCACCTTCCCCAAACTCTTCCCAGATTCCCTCTTC
CCAGCGGACTCCGAGCACAATAAACTCAAAGCCAGCCAAGCCAGGGACTTGTTGTCAAAGATGCTAGTGA
TTGACCCAGCAAAAAGAATATCAGTGGACGACGCCTTACAGCATCCCTACATCAACGTCTGGTATGACCC
AGCCGAAGTGGAGGCGCCTCCACCTCAGATATATGACAAGCAGTTGGATGAAAGAGAACACACAATTGAA
GAATGGAAAGAACTTATCTACAAGGAAGTAATGAATTCAGAAGAAAAGACTAAAAATGGTGTAGTAAAAG
GACAGCCTTCTCCTTCAGGTGCAGCAGTGAACAGCAGTGAGAGTCTCCCTCCATCCTCGTCTGTCAATGA
CATCTCCTCCATGTCCACCGACCAGACCCTGGCATCTGACACTGACAGCAGCCTGGAAGCCTCGGCAGGA
CCCCTGGGTTGTTGCAGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_138980
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138980.3, NP_620446.1
RefSeq Size 7058 bp
RefSeq ORF 1281 bp
Locus ID 5602
Cytogenetics 4q21.3
Domains pkinase
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Adipocytokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, Wnt signaling pathway
Gene Summary 'The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as integration points for multiple biochemical signals, and thus are involved in a wide variety of cellular processes, such as proliferation, differentiation, transcription regulation and development. This kinase is specifically expressed in a subset of neurons in the nervous system, and is activated by threonine and tyrosine phosphorylation. Targeted deletion of this gene in mice suggests that it may have a role in stress-induced neuronal apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene, and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2017]'
Transcript Variant: This variant (3) uses an alternate acceptor splice site in the 5' region, which results in translation initiation from an in-frame, downstream start codon compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.