Dystrophia myotonica protein kinase (DMPK) (NM_001081562) Human Untagged Clone

CAT#: SC315964

DMPK (untagged)-Human dystrophia myotonica-protein kinase (DMPK), transcript variant 4


  "NM_001081562" in other vectors (4)

Reconstitution Protocol

USD 1,060.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DMPK"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DMPK
Synonyms DM; DM1; DM1PK; DMK; MDPK; MT-PK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001081562, the custom clone sequence may differ by one or more nucleotides


ATGTCAGCCGAGGTGCGGCTGAGGCGGCTCCAGCAGCTGGTGTTGGACCCGGGCTTCCTGGGGCTGGAGC
CCCTGCTCGACCTTCTCCTGGGCGTCCACCAGGAGCTGGGCGCCTCCGAACTGGCCCAGGACAAGTACGT
GGCCGACTTCTTGCAGTGGGCGGAGCCCATCGTGGTGAGGCTTAAGGAGGTCCGACTGCAGAGGGACGAC
TTCGAGATTCTGAAGGTGATCGGACGCGGGGCGTTCAGCGAGGTAGCGGTAGTGAAGATGAAGCAGACGG
GCCAGGTGTATGCCATGAAGATCATGAACAAGTGGGACATGCTGAAGAGGGGCGAGGTGTCGTGCTTCCG
TGAGGAGAGGGACGTGTTGGTGAATGGGGACCGGCGGTGGATCACGCAGCTGCACTTCGCCTTCCAGGAT
GAGAACTACCTGTACCTGGTCATGGAGTATTACGTGGGCGGGGACCTGCTGACACTGCTGAGCAAGTTTG
GGGAGCGGATTCCGGCCGAGATGGCGCGCTTCTACCTGGCGGAGATTGTCATGGCCATAGACTCGGTGCA
CCGGCTTGGCTACGTGCACAGGGACATCAAACCCGACAACATCCTGCTGGACCGCTGTGGCCACATCCGC
CTGGCCGACTTCGGCTCTTGCCTCAAGCTGCGGGCAGATGGAACGGTGCGGTCGCTGGTGGCTGTGGGCA
CCCCAGACTACCTGTCCCCCGAGATCCTGCAGGCTGTGGGCGGTGGGCCTGGGACAGGCAGCTACGGGCC
CGAGTGTGACTGGTGGGCGCTGGGTGTATTCGCCTATGAAATGTTCTATGGGCAGACGCCCTTCTACGCG
GATTCCACGGCGGAGACCTATGGCAAGATCGTCCACTACAAGGAGCACCTCTCTCTGCCGCTGGTGGACG
AAGGGGTCCCTGAGGAGGCTCGAGACTTCATTCAGCGGTTGCTGTGTCCCCCGGAGACACGGCTGGGCCG
GGGTGGAGCAGGCGACTTCCGGACACATCCCTTCTTCTTTGGCCTCGACTGGGATGGTCTCCGGGACAGC
GTGCCCCCCTTTACACCGGATTTCGAAGGTGCCACCGACACATGCAACTTCGACTTGGTGGAGGACGGGC
TCACTGCCATGGAGACACTGTCGGACATTCGGGAAGGTGCGCCGCTAGGGGTCCACCTGCCTTTTGTGGG
CTACTCCTACTCCTGCATGGCCCTCAGGGACAGTGAGGTCCCAGGCCCCACACCCATGGAACTGGAGGCC
GAGCAGCTGCTTGAGCCACACGTGCAAGCGCCCAGCCTGGAGCCCTCGGTGTCCCCACAGGATGAAACAG
CTGAAGTGGCAGTTCCAGCGGCTGTCCCTGCGGCAGAGGCTGAGGCCGAGGTGACGCTGCGGGAGCTCCA
GGAAGCCCTGGAGGAGGAGGTGCTCACCCGGCAGAGCCTGAGCCGGGAGATGGAGGCCATCCGCACGGAC
AACCAGAACTTCGCCAGTCAACTACGCGAGGCAGAGGCTCGGAACCGGGACCTAGAGGCACACGTCCGGC
AGTTGCAGGAGCGGATGGAGTTGCTGCAGGCAGAGGGAGCCACAGCTGTCACGGGGGTCCCCAGTCCCCG
GGCCACGGATCCACCTTCCCATATGGCCCCCCGGCCGTGGCTGTGGGCCAGTGCCCGCTGGTGGGGCCAG
GCCCCATGCACCGCCGCCACCTGCTGCTCCCTGCCAGGGTCCCTAGGCCTGGCCTATCGGAGGCGCTTTC
CCTGCTCCTGTTCGCCGTTGTTCTGTCTCGTGCCGCCGCCCTGGGCTGCATTGGGTTGGTGGCCCACGCC
GGCCAACTCACCGCAGTCTGGCGCCGCCCAGGAGCCGCCCGCGCTCCCTGAACCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001081562
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001081562.2, NP_001075031.1
RefSeq Size 2855 bp
RefSeq ORF 1878 bp
Locus ID 1760
Cytogenetics 19q13.32
Protein Families Druggable Genome, Protein Kinase
Gene Summary 'The protein encoded by this gene is a serine-threonine kinase that is closely related to other kinases that interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the beta-subunit of the L-type calcium channels, and phospholemman. The 3' untranslated region of this gene contains 5-38 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-5,000 copies causes myotonic dystrophy type I, which increases in severity with increasing repeat element copy number. Repeat expansion is associated with condensation of local chromatin structure that disrupts the expression of genes in this region. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2016]'
Transcript Variant: This variant (4) has multiple differences in the presence and absence of exons at its 5' end and in the CDS, compared to variant 1. These differences produce a distinct 5' UTR, and cause translation initiation at an alternative start codon, the loss of an in-frame portion of the coding region and a frameshift in the 3' coding region, compared to variant 1. The encoded protein (isoform 4) has a distinct N-terminus and a unique C-terminus, and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.