GnRH (GNRH1) (NM_001083111) Human Untagged Clone
CAT#: SC315978
GNRH1 (untagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2
"NM_001083111" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | GNRH1 |
| Synonyms | GNRH; GRH; LHRH; LNRH |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001083111, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCAATTCAAAAACTCCTAGCTGGCCTTATTCTACTGACTTGGTGCGTGGAAGGCTGCTCCAGCC AGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGATGCCGAAAATTTGATTGATTCTTTCCAAGA GATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGCTTCGAATGCACCACGCACCAGCCACGTTCT CCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGATTGAAGAGGAAACTGGGCAGAAGAAGATTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001083111 |
| ORF Size | 279 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001083111.1, NP_001076580.1 |
| RefSeq Size | 1297 |
| RefSeq ORF | 279 |
| Locus ID | 2796 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | GnRH signaling pathway |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) differs at the 5' end compared to variant 1, which results in translation initiation from an in-frame downstream start codon, and an isoform (2) with a shorter N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219734 | GNRH1 (Myc-DDK-tagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2 |
USD 150.00 |
|
| RG219734 | GNRH1 (GFP-tagged) - Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2 |
USD 460.00 |
|
| RC219734L3 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC219734L4 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China