CD33 (NM_001082618) Human Untagged Clone

CAT#: SC315982

CD33 (untagged)-Human CD33 molecule (CD33), transcript variant 2


  "NM_001082618" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CD33"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD33
Synonyms p67; SIGLEC-3; SIGLEC3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001082618 edited
CAGACATGCCGCTGCTGCTACTGCTGCCCCTGCTGTGGGCAGACTTGACCCACAGGCCCA
AAATCCTCATCCCTGGCACTCTAGAACCCGGCCACTCCAAAAACCTGACCTGCTCTGTGT
CCTGGGCCTGTGAGCAGGGAACACCCCCGATCTTCTCCTGGTTGTCAGCTGCCCCCACCT
CCCTGGGCCCCAGGACTACTCACTCCTCGGTGCTCATAATCACCCCACGGCCCCAGGACC
ACGGCACCAACCTGACCTGTCAGGTGAAGTTCGCTGGAGCTGGTGTGACTACGGAGAGAA
CCATCCAGCTCAACGTCACCTATGTTCCACAGAACCCAACAACTGGTATCTTTCCAGGAG
ATGGCTCAGGGAAACAAGAGACCAGAGCAGGAGTGGTTCATGGGGCCATTGGAGGAGCTG
GTGTTACAGCCCTGCTCGCTCTTTGTCTCTGCCTCATCTTCTTCATAGTGAAGACCCACA
GGAGGAAAGCAGCCAGGACAGCAGTGGGCAGGAATGACACCCACCCTACCACAGGGTCAG
CCTCCCCGAAACACCAGAAGAAGTCCAAGTTACATGGCCCCACTGAAACCTCAAGCTGTT
CAGGTGCCGCCCCTACTGTGGAGATGGATGAGGAGCTGCATTATGCTTCCCTCAACTTTC
ATGGGATGAATCCTTCCAAGGACACCTCCACCGAATACTCAGAGGTCAGGACCCAGTGAG
GAACCCACAAGAGCATCAGGCTCAGCTAGAAGATCCACATCCTCTACAGGTCGGGGACCA
AAGGCTGATTCTTGGAGATTTAACACCCCACAGGCAATGGGTTTATAGACATTATGTGAG
TTTCCTGCTATATTAACATCATCTTAGACTTTGCAAGCAGAGAGTCGTGGAATCAAATCT
GTGCTCTTTCATTTGCTAAGTGTATGATGTCACACAAGCTCCTTAACCTTCCATGTCTCC
ATTTTCTTCTCTGTGAAGTAGGTATAAGAAGTCCTATCTCATAGGGATGCTGTGAGCATT
AAATAAAGGTACACATGGAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001082618
Insert Size 1000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001082618.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001082618.1, NP_001076087.1
RefSeq Size 1085 bp
RefSeq ORF 714 bp
Locus ID 945
Cytogenetics 19q13.41
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage
Gene Summary ''
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2, also known as CD33m), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.