DNAJB2 (NM_006736) Human Untagged Clone
CAT#: SC315992
DNAJB2 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2
"NM_006736" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DNAJB2 |
Synonyms | CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_006736, the custom clone sequence may differ by one or more nucleotides
ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAGAAGGCGTATC GGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAGTTTGCTGAGAAGAAATTTAA GGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACAAGCACAAGCGGGAGATTTACGACCGCTATGGCCGG GAAGGGCTGACAGGGACAGGAACTGGCCCATCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCT TCACCTTCCGCAGCCCCGAGGAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCTT TGATGACCTGGGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCTTTACCTTC TCTTCCTCCTTCCCTGGGCACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGGGCTGGTGCTT TTCGCTCTGTTTCTACATCTACCACCTTTGTCCAAGGACGCCGCATCACCACACGCAGAATCATGGAGAA CGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTGAAGTCAGTCACAATCAATGGTGTCCCAGAT GACCTGGCACTGGGCTTGGAGCTGAGCCGTCGCGAGCAGCAGCCGTCAGTCACTTCCAGGTCTGGGGGCA CTCAGGTCCAGCAGACCCCTGCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAGGACCTGCAGCT GGCCATGGCCTACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGGTGGGCGGGAGGCACAG CACCGACGGCAGGGGCGGCCCAAGGCCCAGCACCAAGATCCAGGCTTGGGGGGGACCCAGGAGGGTGCGA GGGGTGAAGCAACCAAACGCAGTCCATCCCCAGAGGAGAAGGCCTCTCGCTGCCTCATCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_006736 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006736.5, NP_006727.2 |
RefSeq Size | 3129 bp |
RefSeq ORF | 975 bp |
Locus ID | 3300 |
Cytogenetics | 2q35 |
Domains | DnaJ, UIM |
Gene Summary | 'This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]' Transcript Variant: This variant (2) is alternatively spliced at the 3' end compared to variant 1. This results in a longer isoform (b) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201081 | DNAJB2 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2 |
USD 98.00 |
|
RG201081 | DNAJB2 (GFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2 |
USD 460.00 |
|
RC201081L3 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC201081L4 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review