E2F5 (NM_001083589) Human Untagged Clone

CAT#: SC316042

E2F5 (untagged)-Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: E2F5
• Synonyms: E2F-5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001083589, the custom clone sequence may differ by one or more nucleotides
  ATGGACGATTCCATTAATAATAGATTTTCCTATGTAACTCATGAAGACATCTGTAATTGC
  TTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCC
  ATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCA
  GGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTT
  CCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACT
  CCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGC
  CAGGCTCTGCAGCAGACATCAGCTACAGATATATCTTCAGCAGGATCTATTAGTGGAGAT
  ATCATTGATGAGTTAATGTCTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCG
  GCAGATGACTACAACTTTAATTTAGATGATAACGAAGGAGTTTGTGATCTGTTTGATGTC
  CAGATACTAAATTAT
  
• Restriction Sites: Please inquire
• ACCN: NM_001083589
• ORF Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001083589.1, NP_001077058.1
• RefSeq Size: 1594
• RefSeq ORF: 558
• Locus ID: 1875
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Cell cycle, TGF-beta signaling pathway
• Gene Summary: The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus when compared to isoform 1.