FUT3 (NM_001097639) Human Untagged Clone

CAT#: SC316192

FUT3 (untagged)-Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 2


  "NM_001097639" in other vectors (4)

Reconstitution Protocol

USD 760.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FUT3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FUT3
Synonyms CD174; FT3B; FucT-III; LE; Les
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene SC316192 ORF sequence for NM_001097639, the custom clone sequence may differ by one or more nucleotides


ATGGATCCCCTGGGTGCAGCCAAGCCACAATGGCCATGGCGCCGCTGTCTGGCCGCACTGCTATTTCAGC
TGCTGGTGGCTGTGTGTTTCTTCTCCTACCTGCGTGTGTCCCGAGACGATGCCACTGGATCCCCTAGGGC
TCCCAGTGGGTCCTCCCGACAGGACACCACTCCCACCCGCCCCACCCTCCTGATCCTGCTATGGACATGG
CCTTTCCACATCCCTGTGGCTCTGTCCCGCTGTTCAGAGATGGTGCCCGGCACAGCCGACTGCCACATCA
CTGCCGACCGCAAGGTGTACCCACAGGCAGACACGGTCATCGTGCACCACTGGGATATCATGTCCAACCC
TAAGTCACGCCTCCCACCTTCCCCGAGGCCGCAGGGGCAGCGCTGGATCTGGTTCAACTTGGAGCCACCC
CCTAACTGCCAGCACCTGGAAGCCCTGGACAGATACTTCAATCTCACCATGTCCTACCGCAGCGACTCCG
ACATCTTCACGCCCTACGGCTGGCTGGAGCCGTGGTCCGGCCAGCCTGCCCACCCACCGCTCAACCTCTC
GGCCAAGACCGAGCTGGTGGCCTGGGCGGTGTCCAACTGGAAGCCGGACTCAGCCAGGGTGCGCTACTAC
CAGAGCCTGCAGGCTCATCTCAAGGTGGACGTGTACGGACGCTCCCACAAGCCCCTGCCCAAGGGGACCA
TGATGGAGACGCTGTCCCGGTACAAGTTCTACCTGGCCTTCGAGAACTCCTTGCACCCCGACTACATCAC
CGAGAAGCTGTGGAGGAACGCCCTGGAGGCCTGGGCCGTGCCCGTGGTGCTGGGCCCCAGCAGAAGCAAC
TACGAGAGGTTCCTGCCACCCGACGCCTTCATCCACGTGGACGACTTCCAGAGCCCCAAGGACCTGGCCC
GGTACCTGCAGGAGCTGGACAAGGACCACGCCCGCTACCTGAGCTACTTTCGCTGGCGGGAGACGCTGCG
GCCTCGCTCCTTCAGCTGGGCACTGGATTTCTGCAAGGCCTGCTGGAAACTGCAGCAGGAATCCAGGTAC
CAGACGGTGCGCAGCATAGCGGCTTGGTTCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001097639
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001097639.1, NP_001091108.1
RefSeq Size 2259 bp
RefSeq ORF 1086 bp
Locus ID 2525
Cytogenetics 19p13.3
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary 'The Lewis histo-blood group system comprises a set of fucosylated glycosphingolipids that are synthesized by exocrine epithelial cells and circulate in body fluids. The glycosphingolipids function in embryogenesis, tissue differentiation, tumor metastasis, inflammation, and bacterial adhesion. They are secondarily absorbed to red blood cells giving rise to their Lewis phenotype. This gene is a member of the fucosyltransferase family, which catalyzes the addition of fucose to precursor polysaccharides in the last step of Lewis antigen biosynthesis. It encodes an enzyme with alpha(1,3)-fucosyltransferase and alpha(1,4)-fucosyltransferase activities. Mutations in this gene are responsible for the majority of Lewis antigen-negative phenotypes. Differences in the expression of this gene are associated with host susceptibility to viral infection. [provided by RefSeq, Aug 2020]'
Transcript Variant: This variant (2), also known as major II, differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.