FUT3 (NM_001097640) Human Untagged Clone
CAT#: SC316193
FUT3 (untagged)-Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 3
"NM_001097640" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FUT3 |
Synonyms | CD174; FT3B; FucT-III; LE; Les |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001097640, the custom clone sequence may differ by one or more nucleotides
ATGGATCCCCTGGGTGCAGCCAAGCCACAATGGCCATGGCGCCGCTGTCTGGCCGCACTG CTATTTCAGCTGCTGGTGGCTGTGTGTTTCTTCTCCTACCTGCGTGTGTCCCGAGACGAT GCCACTGGATCCCCTAGGGCTCCCAGTGGGTCCTCCCGACAGGACACCACTCCCACCCGC CCCACCCTCCTGATCCTGCTATGGACATGGCCTTTCCACATCCCTGTGGCTCTGTCCCGC TGTTCAGAGATGGTGCCCGGCACAGCCGACTGCCACATCACTGCCGACCGCAAGGTGTAC CCACAGGCAGACACGGTCATCGTGCACCACTGGGATATCATGTCCAACCCTAAGTCACGC CTCCCACCTTCCCCGAGGCCGCAGGGGCAGCGCTGGATCTGGTTCAACTTGGAGCCACCC CCTAACTGCCAGCACCTGGAAGCCCTGGACAGATACTTCAATCTCACCATGTCCTACCGC AGCGACTCCGACATCTTCACGCCCTACGGCTGGCTGGAGCCGTGGTCCGGCCAGCCTGCC CACCCACCGCTCAACCTCTCGGCCAAGACCGAGCTGGTGGCCTGGGCGGTGTCCAACTGG AAGCCGGACTCAGCCAGGGTGCGCTACTACCAGAGCCTGCAGGCTCATCTCAAGGTGGAC GTGTACGGACGCTCCCACAAGCCCCTGCCCAAGGGGACCATGATGGAGACGCTGTCCCGG TACAAGTTCTACCTGGCCTTCGAGAACTCCTTGCACCCCGACTACATCACCGAGAAGCTG TGGAGGAACGCCCTGGAGGCCTGGGCCGTGCCCGTGGTGCTGGGCCCCAGCAGAAGCAAC TACGAGAGGTTCCTGCCACCCGACGCCTTCATCCACGTGGACGACTTCCAGAGCCCCAAG GACCTGGCCCGGTACCTGCAGGAGCTGGACAAGGACCACGCCCGCTACCTGAGCTACTTT CGCTGGCGGGAGACGCTGCGGCCTCGCTCCTTCAGCTGGGCACTGGATTTCTGCAAGGCC TGCTGGAAACTGCAGCAGGAATCCAGGTACCAGACGGTGCGCAGCATAGCGGCTTGGTTC ACC |
Restriction Sites | Please inquire |
ACCN | NM_001097640 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001097640.1, NP_001091109.1 |
RefSeq Size | 2205 bp |
RefSeq ORF | 1086 bp |
Locus ID | 2525 |
Cytogenetics | 19p13.3 |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
Gene Summary | 'The Lewis histo-blood group system comprises a set of fucosylated glycosphingolipids that are synthesized by exocrine epithelial cells and circulate in body fluids. The glycosphingolipids function in embryogenesis, tissue differentiation, tumor metastasis, inflammation, and bacterial adhesion. They are secondarily absorbed to red blood cells giving rise to their Lewis phenotype. This gene is a member of the fucosyltransferase family, which catalyzes the addition of fucose to precursor polysaccharides in the last step of Lewis antigen biosynthesis. It encodes an enzyme with alpha(1,3)-fucosyltransferase and alpha(1,4)-fucosyltransferase activities. Mutations in this gene are responsible for the majority of Lewis antigen-negative phenotypes. Differences in the expression of this gene are associated with host susceptibility to viral infection. [provided by RefSeq, Aug 2020]' Transcript Variant: This variant (3), also known as major I, differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224551 | FUT3 (Myc-DDK-tagged)-Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 3 |
USD 420.00 |
|
RG224551 | FUT3 (GFP-tagged) - Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 3 |
USD 460.00 |
|
RC224551L3 | Lenti-ORF clone of FUT3 (Myc-DDK-tagged)-Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 3 |
USD 620.00 |
|
RC224551L4 | Lenti-ORF clone of FUT3 (mGFP-tagged)-Human fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group) (FUT3), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review