SEPP1 (SELENOP) (NM_001085486) Human Untagged Clone
CAT#: SC316197
SEPP1 (untagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
"NM_001085486" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Symbol | SELENOP |
Synonyms | SELP; SeP; SEPP; SEPP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001085486, the custom clone sequence may differ by one or more nucleotides
ATGTGGAGAAGCCTGGGGCTTGCCCTGGCTCTCTGTCTCCTCCCATCGGGAGGAACAGAGAGCCAGGACC AAAGCTCCTTATGTAAGCAACCCCCAGCCTGGAGCATAAGAGATCAAGATCCAATGCTAAACTCCAATGG TTCAGTGACTGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCATACTGCAGGCATCTAAATTAGAA GACCTGCGAGTAAAACTGAAGAAAGAAGGATATTCTAATATTTCTTATATTGTTGTTAATCATCAAGGAA TCTCTTCTCGATTAAAATACACACATCTTAAGAATAAGGTTTCAGAGCATATTCCTGTTTATCAACAAGA AGAAAACCAAACAGATGTCTGGACTCTTTTAAATGGAAGCAAAGATGACTTCCTCATATATGATAGATGT GGCCGTCTTGTATATCATCTTGGTTTGCCTTTTTCCTTCCTAACTTTCCCATATGTAGAAGAAGCCATTA AGATTGCTTACTGTGAAAAGAAATGTGGAAACTGCTCTCTCACGACTCTCAAAGATGAAGACTTTTGTAA ACGTGTATCTTTGGCTACTGTGGATAAAACAGTTGAAACTCCATCGCCTCATTACCATCATGAGCATCAT CACAATCATGGACATCAGCACCTTGGCAGCAGTGAGCTTTCAGAGAATCAGCAACCAGGAGCACCAAATG CTCCTACTCATCCTGCTCCTCCAGGCCTTCATCACCACCATAAGCACAAGGGTCAGCATAGGCAGGGTCA CCCAGAGAACCGAGATATGCCAGCAAGTGAAGATTTACAAGATTTACAAAAGAAGCTCTGTCGAAAGAGA TGTATAAATCAATTACTCTGTAAATTGCCCACAGATTCAGAGTTGGCTCCTAGGAGCTGATGCTGCCATT GTCGACATCTGATATTTGAAAAAACAGGGTCTGCAATCACCTGACAGTGTAAAGAAAACCTCCCATCTTT ATGTAGCTGACAGGGACTTCGGGCAGAGGAGAACATAACTGAATCTTGTCAGTGACGTTTGCCTCCAGCT GCCTGACAAATAAGTCAGCAGCTTATACCCACAGAAGCCAGTGCCAGTTGACGCTGAAAGAATCAGGCAA AAAAGTGAGAATGACCTTCAAACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001085486 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001085486.1, NP_001078955.1 |
RefSeq Size | 2193 bp |
Locus ID | 6414 |
Cytogenetics | 5p12 |
Protein Families | Secreted Protein |
Gene Summary | 'This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in human), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. The use of alternative polyadenylation sites, one located in between the two SECIS elements, results in two populations of mRNAs containing either both (predominant) or just the upstream SECIS element (PMID:27881738). Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2018]' Transcript Variant: This variant (2, also known as Sepp1c) contains an additional 5' non-coding exon, and thus has a different and longer 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218097 | SEPP1 (Myc-DDK-tagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
USD 420.00 |
|
RG218097 | SEPP1 (GFP-tagged) - Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
USD 460.00 |
|
RC218097L3 | Lenti-ORF, SEPP1 (Myc-DDK-tagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) |
USD 620.00 |
|
RC218097L4 | Lenti-ORF, SEPP1 (mGFP-tagged) - Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (Note: selenocysteine protein, Internal stop codon present. See Summary below) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review