SEPP1 (SELENOP) (NM_001085486) Human Untagged Clone

CAT#: SC316197

SEPP1 (untagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)

Specifications

Product Data

• Type: Human Untagged Clone
• Symbol: SELENOP
• Synonyms: SELP; SeP; SEPP; SEPP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001085486, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGAGAAGCCTGGGGCTTGCCCTGGCTCTCTGTCTCCTCCCATCGGGAGGAACAGAGAGCCAGGACC
  AAAGCTCCTTATGTAAGCAACCCCCAGCCTGGAGCATAAGAGATCAAGATCCAATGCTAAACTCCAATGG
  TTCAGTGACTGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCATACTGCAGGCATCTAAATTAGAA
  GACCTGCGAGTAAAACTGAAGAAAGAAGGATATTCTAATATTTCTTATATTGTTGTTAATCATCAAGGAA
  TCTCTTCTCGATTAAAATACACACATCTTAAGAATAAGGTTTCAGAGCATATTCCTGTTTATCAACAAGA
  AGAAAACCAAACAGATGTCTGGACTCTTTTAAATGGAAGCAAAGATGACTTCCTCATATATGATAGATGT
  GGCCGTCTTGTATATCATCTTGGTTTGCCTTTTTCCTTCCTAACTTTCCCATATGTAGAAGAAGCCATTA
  AGATTGCTTACTGTGAAAAGAAATGTGGAAACTGCTCTCTCACGACTCTCAAAGATGAAGACTTTTGTAA
  ACGTGTATCTTTGGCTACTGTGGATAAAACAGTTGAAACTCCATCGCCTCATTACCATCATGAGCATCAT
  CACAATCATGGACATCAGCACCTTGGCAGCAGTGAGCTTTCAGAGAATCAGCAACCAGGAGCACCAAATG
  CTCCTACTCATCCTGCTCCTCCAGGCCTTCATCACCACCATAAGCACAAGGGTCAGCATAGGCAGGGTCA
  CCCAGAGAACCGAGATATGCCAGCAAGTGAAGATTTACAAGATTTACAAAAGAAGCTCTGTCGAAAGAGA
  TGTATAAATCAATTACTCTGTAAATTGCCCACAGATTCAGAGTTGGCTCCTAGGAGCTGATGCTGCCATT
  GTCGACATCTGATATTTGAAAAAACAGGGTCTGCAATCACCTGACAGTGTAAAGAAAACCTCCCATCTTT
  ATGTAGCTGACAGGGACTTCGGGCAGAGGAGAACATAACTGAATCTTGTCAGTGACGTTTGCCTCCAGCT
  GCCTGACAAATAAGTCAGCAGCTTATACCCACAGAAGCCAGTGCCAGTTGACGCTGAAAGAATCAGGCAA
  AAAAGTGAGAATGACCTTCAAACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001085486
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
• OTI Annotation: This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001085486.1, NP_001078955.1
• RefSeq Size: 2193 bp
• Locus ID: 6414
• Cytogenetics: 5p12
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in human), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. The use of alternative polyadenylation sites, one located in between the two SECIS elements, results in two populations of mRNAs containing either both (predominant) or just the upstream SECIS element (PMID:27881738). Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2018]'
  Transcript Variant: This variant (2, also known as Sepp1c) contains an additional 5' non-coding exon, and thus has a different and longer 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).