MIA40 (CHCHD4) (NM_001098502) Human Untagged Clone

CAT#: SC316333

CHCHD4 (untagged)-Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHCHD4
• Synonyms: MIA40; TIMM40
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001098502, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTATTGCCGGCAGGAAGGGAAGGATCGAATCATATTTGTAACCAAAGAAGATCATGAAACTCCAA
  GCAGTGCAGAATTGGTGGCTGATGACCCCAACGATCCATACGAGGAGCATGGATTGATACTGCCAAATGG
  AAACATTAACTGGAACTGCCCATGCCTTGGGGGAATGGCCAGCGGTCCCTGTGGAGAACAGTTTAAGTCA
  GCCTTTTCCTGCTTCCACTATAGCACGGAGGAGATCAAGGGGTCAGACTGTGTAGACCAGTTCCGGGCCA
  TGCAGGAATGCATGCAGAAATACCCAGACCTCTATCCCCAAGAGGATGAGGATGAGGAAGAGGAAAGAGA
  GAAGAAGCCAGCAGAACAAGCAGAAGAAACAGCTCCCATTGAGGCCACTGCAACCAAAGAAGAGGAGGGA
  TCAAGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001098502
• ORF Size: 429 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001098502.1, NP_001091972.1
• RefSeq Size: 1476
• RefSeq ORF: 429
• Locus ID: 131474
• Gene Summary: CHCHD4, a component of human mitochondria, belongs to a protein family whose members share 6 highly conserved cysteine residues constituting a -CXC-CX(9)C-CX(9)C- motif in the C terminus (Hofmann et al., 2005 [PubMed 16185709]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (1) is the predominant transcript. It does not contain an N-terminal, cleavable mitochondrial target sequence, yet experimental studies have determined that the encoded protein (isoform 1) is found within the intermembrane space of the mitochondrion.