DEP1 (PTPRJ) (NM_001098503) Human Untagged Clone
CAT#: SC316400
PTPRJ (untagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2
"NM_001098503" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPRJ |
Synonyms | CD148; DEP1; HPTPeta; R-PTP-ETA; SCC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001098503, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCGGCGGCGCGGGAGGCGCGGCTGCCTCCGCGCTCGCCCGGGCTGCGCTGGGCGCTGCCGCTGC TGCTGCTGCTGCTGCGCCTGGGCCAGATCCTGTGCGCAGGTGGCACCCCTAGTCCAATTCCTGACCCTTC AGTAGCAACTGTTGCCACAGGGGAAAATGGCATAACGCAGATCAGCAGTACAGCAGAATCCTTTCATAAA CAGAATGGAACTGGAACACCTCAGGTGGAAACAAACACCAGTGAGGATGGTGAAAGCTCTGGAGCCAACG ATAGTTTAAGAACACCTGAACAAGGATCTAATGGGACTGATGGGGCATCTCAAAAAACTCCCAGTAGCAC TGGGCCCAGTCCTGTGTTTGACATTAAAGCTGTTTCCATCAGTCCAACCAATGTGATCTTAACTTGGAAA AGTAATGACACAGCTGCTTCTGAGTACAAGTATGTAGTAAAGCATAAGATGGAAAATGAGAAGACAATTA CTGTTGTGCATCAACCATGGTGTAACATCACAGGCTTACGTCCAGCGACTTCATATGTATTCTCCATCAC TCCAGGAATAGGCAATGAGACTTGGGGAGATCCCAGAGTCATAAAAGTCATCACAGAGCCGATCCCAGTT TCTGATCTCCGTGTTGCCCTCACGGGTGTGAGGAAGGCTGCTCTCTCCTGGAGCAATGGCAATGGCACTG CCTCCTGCCGGGTTCTTCTTGAAAGCATTGGAAGCCATGAGGAGTTGACTCAAGACTCAAGACTTCAGGT CAATATCTCGGGCCTGAAGCCAGGGGTTCAATACAACATCAACCCGTATCTTCTACAATCAAATAAGACA AAGGGAGACCCCTTGGGCACAGAAGGTGGCTTGGATGCCAGCAATACAGAGAGAAGCCGGGCAGGGAGCC CCACCGCCCCTGTGCATGATGAGTCCCTCGTGGGACCTGTGGACCCATCCTCCGGCCAGCAGTCCCGAGA CACGGAAGTCCTGCTTGTCGGGTTAGAGCCTGGCACCCGATACAATGCCACCGTTTATTCCCAAGCAGCG AATGGCACAGAAGGACAGCCCCAGGCCATAGAGTTCAGGACAAATGCTATTCAGGTTTTTGACGTCACCG CTGTGAACATCAGTGCCACAAGCCTGACCCTGATCTGGAAAGTCAGCGATAACGAGTCGTCATCTAACTA TACCTACAAGATACATGTGGCGGGGGAGACAGATTCTTCCAATCTCAACGTCAGTGAGCCTCGCGCTGTC ATCCCCGGACTCCGCTCCAGCACCTTCTACAACATCACAGTGTGTCCTGTCCTAGGTGACATCGAGGGCA CGCCGGGCTTCCTCCAAGTGCACACCCCCCCTGTTCCAGTTTCTGACTTCCGAGTGACAGTGGTCAGCAC GACGGAGATCGGCTTAGCATGGAGCAGCCATGATGCAGAATCATTTCAGATGCATATCACACAGGAGGGA GCTGGCAATTCTCGGGTAGAAATAACCACCAACCAAAGTATTATCATTGGTGGCTTGTTCCCTGGAACCA AGTATTGCTTTGAAATAGTTCCAAAAGGACCAAATGGGACTGAAGGGGCATCTCGGACAGTTTGCAATAG AACTGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098503 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098503.1, NP_001091973.1 |
RefSeq Size | 3193 bp |
RefSeq ORF | 1620 bp |
Locus ID | 5795 |
Cytogenetics | 11p11.2 |
Protein Families | Druggable Genome, Phosphatase, Transmembrane |
Protein Pathways | Adherens junction |
Gene Summary | 'The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) has multiple differences in the presence and absence of exons at its 3' end, compared to variant 1. These differences produce a unique 3' UTR, compared to variant 1, and the encoded protein (isoform 2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211673 | PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 500.00 |
|
RG211673 | PTPRJ (GFP-tagged) - Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 550.00 |
|
RC211673L1 | Lenti-ORF clone of PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 864.00 |
|
RC211673L2 | Lenti-ORF clone of PTPRJ (mGFP-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 700.00 |
|
RC211673L3 | Lenti-ORF clone of PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 864.00 |
|
RC211673L4 | Lenti-ORF clone of PTPRJ (mGFP-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 |
USD 700.00 |
{0} Product Review(s)
Be the first one to submit a review