Mammaglobin A (SCGB2A2) (NM_002411) Human Untagged Clone

CAT#: SC316462

SCGB2A2 (untagged)-Human secretoglobin, family 2A, member 2 (SCGB2A2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SCGB2A2
• Synonyms: MGB1; UGB2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_002411 edited
  ATGAAGTTGCTGATGGTCCTCATGCTGGCGGCCCTCTCCCAGCACTGCTACGCAGGCTCT
  GGCTGCCCCTTATTGGAGAATGTGATTTCCAAGACAATCAATCCACAAGTGTCTAAGACT
  GAATACAAAGAACTTCTTCAAGAGTTCATAGACGACAATGCCACTACAAATGCCATAGAT
  GAATTGAAGGAATGTTTTCTTAACCAAACGGATGAAACTCTGAGCAATGTTGAGGTGTTT
  ATGCAATTAATATATGACAGCAGTCTTTGTGATTTATTTTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_002411
• Insert Size: 1300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: no
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002411.2, NP_002402.1
• RefSeq Size: 502 bp
• RefSeq ORF: 282 bp
• Locus ID: 4250
• Cytogenetics: 11q12.3
• Gene Summary: ''