Septin 8 (SEPT8) (NM_001098813) Human Untagged Clone
CAT#: SC316511
41525 (untagged)-Human septin 8 (SEPT8), transcript variant 4
"NM_001098813" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEPT8 |
Synonyms | SEP2; SEPT8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001098813, the custom clone sequence may differ by one or more nucleotides
ATGAACACACTCTTCAACACGACCTTCGAGACTGAGGAAGCCAGTCACCATGAGGCATGCGTGCGCCTGC GGCCCCAGACCTATGACCTCCAGGAGAGCAACGTGCAGCTCAAGCTGACCATTGTGGATGCCGTGGGCTT TGGGGATCAGATCAATAAGGATGAGAGTTACAGGCCCATAGTTGACTACATCGATGCGCAGTTTGAAAAT TATCTGCAGGAGGAGCTGAAGATCCGCCGCTCGCTCTTCGACTACCATGACACAAGGATCCACGTTTGCC TCTACTTCATCACGCCCACAGGGCACTCCCTGAAGTCTCTAGATCTAGTGACCATGAAGAAACTAGACAG CAAGGTGAACATTATTCCCATCATCGCCAAGGCTGACACCATCTCCAAGAGCGAGCTCCACAAGTTCAAG ATCAAGATCATGGGCGAGTTGGTCAGCAACGGGGTCCAGATCTACCAGTTCCCCACGGATGATGAGGCTG TTGCAGAGATTAACGCAGTCATGAATGCACATCTGCCCTTTGCCGTGGTGGGCAGCACCGAGGAGGTGAA GGTGGGGAACAAGCTGGTCCGAGCACGGCAGTACCCCTGGGGAGTGGTGCAGGTGGAGAATGAGAATCAC TGCGACTTCGTGAAGCTGCGGGAGATGTTGATCCGGGTGAACATGGAAGACCTCCGCGAGCAGACCCACA GCCGGCACTACGAGCTCTACCGGCGCTGCAAGTTGGAGGAGATGGGCTTTCAGGACAGCGATGGTGACAG CCAGCCCTTCAGCCTACAAGAGACATACGAGGCCAAGAGGAAGGAGTTCCTAAGTGAGCTGCAGAGGAAG GAGGAAGAGATGAGGCAGATGTTTGTCAACAAAGTGAAGGAGACAGAGCTGGAGCTGAAGGAGAAGGAAA GGGAGCTCCATGAGAAGTTTGAGCACCTGAAGCGGGTCCACCAGGAGGAGAAGCGCAAGGTGGAGGAAAA GCGCCGGGAACTGGAGGAGGAGACCAACGCCTTCAATCGCCGGAAGGCTGCGGTGGAGGCCCTGCAGTCG CAGGCCTTGCACGCCACCTCGCAGCAGCCCCTGAGGAAGGACAAGGACAAGAAGAATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098813 |
ORF Size | 1110 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001098813.1, NP_001092283.1 |
RefSeq Size | 4270 |
RefSeq ORF | 1110 |
Locus ID | 23176 |
Gene Summary | This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and translation termination at an alternate stop codon. The resulting isoform (d) is shorter at the N- and C-termini compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216253 | SEPT8 (Myc-DDK-tagged)-Human septin 8 (SEPT8), transcript variant 4 |
USD 420.00 |
|
RG216253 | 41525 (GFP-tagged) - Human septin 8 (SEPT8), transcript variant 4 |
USD 460.00 |
|
RC216253L1 | Lenti ORF clone of Human septin 8 (SEPT8), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC216253L2 | Lenti ORF clone of Human septin 8 (SEPT8), transcript variant 4, mGFP tagged |
USD 620.00 |
|
RC216253L3 | Lenti ORF clone of Human septin 8 (SEPT8), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC216253L4 | Lenti ORF clone of Human septin 8 (SEPT8), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review