Septin 8 (SEPT8) (NM_001098813) Human Untagged Clone

CAT#: SC316511

41525 (untagged)-Human septin 8 (SEPT8), transcript variant 4


  "NM_001098813" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEPT8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SEPT8
Synonyms SEP2; SEPT8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001098813, the custom clone sequence may differ by one or more nucleotides


ATGAACACACTCTTCAACACGACCTTCGAGACTGAGGAAGCCAGTCACCATGAGGCATGCGTGCGCCTGC
GGCCCCAGACCTATGACCTCCAGGAGAGCAACGTGCAGCTCAAGCTGACCATTGTGGATGCCGTGGGCTT
TGGGGATCAGATCAATAAGGATGAGAGTTACAGGCCCATAGTTGACTACATCGATGCGCAGTTTGAAAAT
TATCTGCAGGAGGAGCTGAAGATCCGCCGCTCGCTCTTCGACTACCATGACACAAGGATCCACGTTTGCC
TCTACTTCATCACGCCCACAGGGCACTCCCTGAAGTCTCTAGATCTAGTGACCATGAAGAAACTAGACAG
CAAGGTGAACATTATTCCCATCATCGCCAAGGCTGACACCATCTCCAAGAGCGAGCTCCACAAGTTCAAG
ATCAAGATCATGGGCGAGTTGGTCAGCAACGGGGTCCAGATCTACCAGTTCCCCACGGATGATGAGGCTG
TTGCAGAGATTAACGCAGTCATGAATGCACATCTGCCCTTTGCCGTGGTGGGCAGCACCGAGGAGGTGAA
GGTGGGGAACAAGCTGGTCCGAGCACGGCAGTACCCCTGGGGAGTGGTGCAGGTGGAGAATGAGAATCAC
TGCGACTTCGTGAAGCTGCGGGAGATGTTGATCCGGGTGAACATGGAAGACCTCCGCGAGCAGACCCACA
GCCGGCACTACGAGCTCTACCGGCGCTGCAAGTTGGAGGAGATGGGCTTTCAGGACAGCGATGGTGACAG
CCAGCCCTTCAGCCTACAAGAGACATACGAGGCCAAGAGGAAGGAGTTCCTAAGTGAGCTGCAGAGGAAG
GAGGAAGAGATGAGGCAGATGTTTGTCAACAAAGTGAAGGAGACAGAGCTGGAGCTGAAGGAGAAGGAAA
GGGAGCTCCATGAGAAGTTTGAGCACCTGAAGCGGGTCCACCAGGAGGAGAAGCGCAAGGTGGAGGAAAA
GCGCCGGGAACTGGAGGAGGAGACCAACGCCTTCAATCGCCGGAAGGCTGCGGTGGAGGCCCTGCAGTCG
CAGGCCTTGCACGCCACCTCGCAGCAGCCCCTGAGGAAGGACAAGGACAAGAAGAATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001098813
ORF Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001098813.1, NP_001092283.1
RefSeq Size 4270
RefSeq ORF 1110
Locus ID 23176
Gene Summary This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and translation termination at an alternate stop codon. The resulting isoform (d) is shorter at the N- and C-termini compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.