Cytochrome b5 (CYB5A) (NM_001914) Human Untagged Clone

CAT#: SC316637

CYB5A (untagged)-Human cytochrome b5 type A (microsomal) (CYB5A), transcript variant 2


  "NM_001914" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CYB5A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYB5A
Synonyms CYB5; MCB5; METAG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001914 edited
GGGGAATGTCCCGGGTGGAGCTGGCTGAGTCGCGCGCTCTGCTCCACCCGACGGGGCTGT
GTGTGCTGGGCCTGGCTCGCGGCGAACCGAGATGGCAGAGCAGTCGGACGAGGCCGTGAA
GTACTACACCCTAGAGGAGATTCAGAAGCACAACCACAGCAAGAGCACCTGGCTGATCCT
GCACCACAAGGTGTACGATTTGACCAAATTTCTGGAAGAGCATCCTGGTGGGGAAGAAGT
TTTAAGGGAACAAGCTGGAGGTGACGCTACTGAGAACTTTGAGGATGTCGGGCACTCTAC
AGATGCCAGGGAAATGTCCAAAACATTCATCATTGGGGAGCTCCATCCAGATGACAGACC
AAAGTTAAACAAGCCTCCGGAACCTTAAAGGCGGTGTTTCAAGGAAACTCTTATCACTAC
TATTGATTCTAGTTCCAGTTGGTGGACCAACTGGGTGATCCCTGCCATCTCTGCAGTGGC
CGTCGCCTTGATGTATCGCCTATACATGGCAGAGGACTGAACACCTCCTCAGAAGTCAGC
GCAGGAAGAGCCTGCTTTGGACACGGGAGAAAAGAAGCCATTGCTAACTACTTCAACTGA
CAGAAACCTTCACTTGAAAACAATGATTTTAATATATCTCTTTCTTTTTCTTCCGACATT
AGAAACAAAACAAAAAGAACTGTCCTTTCTGCGCTCAAATTTTTCGAGTGTGCCTTTTTA
TTCATCTACTTTATTTTGATGTTTCCTTAATGTGTAATTTACTTATTATAAGCATGATCT
TTTAAAAATATATTTGGCTTTTAAAGTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001914
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001914.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001914.2, NP_001905.1
RefSeq Size 844 bp
RefSeq ORF 297 bp
Locus ID 1528
Cytogenetics 18q22.3
Domains heme_1
Protein Families Transmembrane
Gene Summary 'The protein encoded by this gene is a membrane-bound cytochrome that reduces ferric hemoglobin (methemoglobin) to ferrous hemoglobin, which is required for stearyl-CoA-desaturase activity. Defects in this gene are a cause of type IV hereditary methemoglobinemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]'
Transcript Variant: This variant (2) has an additional exon in the 3' coding region, which introduces a stop codon, as compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.