RBIS (NM_001099672) Human Untagged Clone
CAT#: SC316638
C8orf59 (untagged)-Human chromosome 8 open reading frame 59 (C8orf59), transcript variant 3
"NM_001099672" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RBIS |
Synonyms | C8orf59 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001099672, the custom clone sequence may differ by one or more nucleotides
ATGGCCAAGAACAAATTAAGAGGGCCGAAGTCCAGGAATGTATTTCACATAGCCAGCCAA AAAAACTTTAAGGCTAAAAACAAAGCAAAACCAGTTACCACTAATCTTAAGAAGATAAAC ATTATGAATGAGGAAAAAGTTAACAGAGTAAATAAAGCTTTTGTAAATGTACAAAAGGAA CTTGCACATTTCGCAAAAAGCATTTCACTTGAACCTCTGCAGAAAGAACTGATTCCTCAG CAGCGTCATGAAAGCAAACCAGTTAATGTTGATGAAGCTACAAGATTAATGGCTCTGTTG |
Restriction Sites | Please inquire |
ACCN | NM_001099672 |
ORF Size | 303 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001099672.1, NP_001093142.1 |
RefSeq Size | 963 |
RefSeq ORF | 303 |
Locus ID | 401466 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214795 | C8orf59 (Myc-DDK-tagged)-Human chromosome 8 open reading frame 59 (C8orf59), transcript variant 3 |
USD 420.00 |
|
RG214795 | C8orf59 (GFP-tagged) - Human chromosome 8 open reading frame 59 (C8orf59), transcript variant 3 |
USD 460.00 |
|
RC214795L3 | Lenti-ORF clone of C8orf59 (Myc-DDK-tagged)-Human chromosome 8 open reading frame 59 (C8orf59), transcript variant 3 |
USD 620.00 |
|
RC214795L4 | Lenti-ORF clone of C8orf59 (mGFP-tagged)-Human chromosome 8 open reading frame 59 (C8orf59), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review