ARMS2 (NM_001099667) Human Untagged Clone

CAT#: SC316643

ARMS2 (untagged)-Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ARMS2
• Synonyms: ARMD8
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001099667 edited
  GTCCCTGTACCCTACATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGG
  AAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCC
  ACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAG
  AGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTC
  TGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTCAGCAC
  CACCTGACACTGTCTATCATCCACACTGCAGCAAGGTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001099667
• ORF Size: 324 bp
• Insert Size: 350
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: It is not a varient.

Reference Data

• RefSeq: NM_001099667.1, NP_001093137.1
• RefSeq Size: 823
• RefSeq ORF: 324
• Locus ID: 387715
• Gene Summary: This gene encodes a small secreted protein specific to primates. This protein is a component of the choroidal extracellular matrix of the eye. Mutations in this gene are associated with age-related macular degeneration. [provided by RefSeq, Sep 2017]