ARMS2 (NM_001099667) Human Untagged Clone
CAT#: SC316643
ARMS2 (untagged)-Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein
"NM_001099667" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ARMS2 |
| Synonyms | ARMD8 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001099667 edited
GTCCCTGTACCCTACATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGG AAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCC ACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAG AGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTC TGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTCAGCAC CACCTGACACTGTCTATCATCCACACTGCAGCAAGGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001099667 |
| ORF Size | 324 bp |
| Insert Size | 350 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | It is not a varient. |
| Reference Data | |
| RefSeq | NM_001099667.1, NP_001093137.1 |
| RefSeq Size | 823 |
| RefSeq ORF | 324 |
| Locus ID | 387715 |
| Gene Summary | This gene encodes a small secreted protein specific to primates. This protein is a component of the choroidal extracellular matrix of the eye. Mutations in this gene are associated with age-related macular degeneration. [provided by RefSeq, Sep 2017] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223747 | ARMS2 (Myc-DDK-tagged)-Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein |
USD 150.00 |
|
| RG223747 | ARMS2 (GFP-tagged) - Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
| RC223747L1 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
| RC223747L2 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
| RC223747L3 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
| RC223747L4 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China