TGF alpha (TGFA) (NM_001099691) Human Untagged Clone
CAT#: SC316662
TGFA (untagged)-Human transforming growth factor, alpha (TGFA), transcript variant 2
"NM_001099691" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TGFA |
| Synonyms | TFGA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001099691, the custom clone sequence may differ by one or more nucleotides
ATGGTCCCCTCGGCTGGACAGCTCGCCCTGTTCGCTCTGGGTATTGTGTTGGCTGCGTGCCAGGCCTTGG AGAACAGCACGTCCCCGCTGAGTGACCCGCCCGTGGCTGCAGCAGTGGTGTCCCATTTTAATGACTGCCC AGATTCCCACACTCAGTTCTGCTTCCATGGAACCTGCAGGTTTTTGGTGCAGGAGGACAAGCCAGCATGT GTCTGCCATTCTGGGTACGTTGGTGCACGCTGTGAGCATGCGGACCTCCTGGCCGTGGTGGCTGCCAGCC AGAAGAAGCAGGCCATCACCGCCTTGGTGGTGGTCTCCATCGTGGCCCTGGCTGTCCTTATCATCACATG TGTGCTGATACACTGCTGCCAGGTCCGAAAACACTGTGAGTGGTGCCGGGCCCTCATCTGCCGGCACGAG AAGCCCAGCGCCCTCCTGAAGGGAAGAACCGCTTGCTGCCACTCAGAAACAGTGGTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001099691 |
| ORF Size | 480 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001099691.2, NP_001093161.1 |
| RefSeq Size | 4323 |
| RefSeq ORF | 480 |
| Locus ID | 7039 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | ErbB signaling pathway, Glioma, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma |
| Gene Summary | This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is one amino acid shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218141 | TGFA (Myc-DDK-tagged)-Human transforming growth factor, alpha (TGFA), transcript variant 2 |
USD 225.00 |
|
| RG218141 | TGFA (GFP-tagged) - Human transforming growth factor, alpha (TGFA), transcript variant 2 |
USD 460.00 |
|
| RC218141L3 | Lenti ORF clone of Human transforming growth factor, alpha (TGFA), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC218141L4 | Lenti ORF clone of Human transforming growth factor, alpha (TGFA), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China