NPW (NM_001099456) Human Untagged Clone

CAT#: SC316664

NPW (untagged)-Human neuropeptide W (NPW)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NPW
• Synonyms: L8; L8C; PPL8; PPNPW
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001099456, the custom clone sequence may differ by one or more nucleotides
  
  
  CTGGCGTGGCGCCCAGGGGAGCGGGGGGCTCCCGCGAGCCGGCCGCGGCTGGCACTGCTGCTGCTTCTGC
  TCCTGCTGCCGCTGCCCTCCGGCGCGTGGTACAAGCACGTGGCGAGTCCCCGCTACCACACGGTGGGCCG
  CGCCGCTGGCCTGCTCATGGGGCTGCGTCGCTCACCCTATCTGTGGCGCCGCGCGCTGCGCGCGGCCGCC
  GGGCCCCTGGCCAGGGACACCCTCTCCCCCGAACCCGCAGCCCGCGAGGCTCCTCTCCTGCTGCCCTCGT
  GGGTTCAGGAGCTGTGGGAGACGCGACGCAGGAGCTCCCAGGCAGGGATCCCCGTCCGTGCGCCCCGGAG
  CCCGCGCGCCCCAGAGCCTGCGCTGGAACCGGAGTCCCTGGACTTCAGCGGAGCTGGCCAGAGACTTCGG
  AGAGACGTCTCCCGCCCAGCGGTGGACCCCGCAGCAAACCGCCTTGGCCTGCCCTGCCTGGCCCCCGGAC
  CGTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001099456
• ORF Size: 498 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001099456.2, NP_001092926.2
• RefSeq Size: 1033
• RefSeq ORF: 498
• Locus ID: 283869
• Gene Summary: The product of this gene is processed into 23- and 30-amino acid neuropeptides that bind and activate two G-protein coupled receptors in the central nervous system. The neuropeptides have been shown to enhance cortisol secretion from adrenal cells through the adenylate cyclase/protein kinase A signaling cascade. The preproprotein is translated using a non-AUG initiation codon that is inferred from analyses of the mouse ortholog. [provided by RefSeq, Jul 2008]