PREI3 (MOB4) (NM_001100819) Human Untagged Clone

CAT#: SC316677

MOB4 (untagged)-Human MOB1, Mps One Binder kinase activator-like 3 (yeast) (MOBKL3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MOB4
• Synonyms: 2C4D; CGI-95; MOB1; MOB3; MOBKL3; PHOCN; PREI3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001100819, the custom clone sequence may differ by one or more nucleotides
  ATGGTCATGGCGGAGGGGACGGCAGTGCTGAGGCGGAACAGGCCGGGCACCAAGGCGCAG
  TATATTCAACAGAACATAAGAGCAGATTGCTCCAATATTGACAAAATTCTTGAACCACCT
  GAAGGCCAAGATGAAGGTGTGTGGAAGTATGAACATTTAAGGCAGTTCTGCCTTGAGCTA
  AATGGACTTGCTGTCAAACTTCAGAGTGAATGCCATCCAGATACTTGCACTCAAATGACA
  GCAACTGAACAATGGATTTTTCTTTGTGCAGCTCATAAAACTCCAAAAGAGTGTCCTGCT
  ATAGACTATACTAGACACACACTTGATGGTGCTGCATGTCTTCTGAATAGCAATAAATAT
  TTTCCCAGCAGGGTTAGCATAAAGGAATCATCTGTAGCGAAACTAGGATCAGTATGCCGT
  AGGATTTACAGAATATTTTCACATGCTTATTTTCATCATCGGCAGATATTTGATGAATAT
  GAAAATGAAACATTTTTGTGTCATCGGTTTACTAAGTTTGTGATGAAATACAATTTGATG
  TCCAAGGATAACCTGATTGTACCAATTTTAGAAGAGGAAGTACAGAATTCAGTTTCTGGG
  GAAAGTGAAGCA
  
• Restriction Sites: Please inquire
• ACCN: NM_001100819
• ORF Size: 615 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001100819.1, NP_001094289.1
• RefSeq Size: 2800
• RefSeq ORF: 615
• Locus ID: 25843
• Gene Summary: This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon, compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.